“S CARS ARE T ATTOOED S TORIES WITH B ITTER E NDING.” Presented by Divya.V Department of Chemistry Assistant Professor M.S.M.College, Kayamkulam.

Cancer is the second most common disease in India responsible for maximum mortality with about 0.3 million deaths per year

All types of cancers have been reported in Indian population including the cancers of skin, lungs, breast, rectum, stomach, prostate, liver, cervix, esophagus, bladder, blood, mouth etc.

What is CANCER? Cancer, also known as a malignant tumor or malignant neoplasm, is a group of diseases involving abnormal cell growth with the potential to invade or spread to other parts of the body Hyperplasia.

C ARCINOGENIC AGENTS Radiation electromagnetic radiations and atomic particles not how much radiation is absorbed by the body tissue, but how much damage to DNA is done when the radiation has been absorbed. Chromosomal translocations and deletions by causing ionization and generate dangerous intermediates called reactive oxygen species. Leukemia and skin cancer

C ARCINOGENIC AGENTS Chemical Carcinogen an electrophilic form reacts with nucleophilic sites in the purine and pyramidine rings of nucleic acids. Carcinogenes mainly classified into four groups: Polycyclic aromatic hydrocarbons(PAH) Hetero cyclic amines ( HCA) Nitrosamines Alkylating agents

C ARCINOGENIC AGENTS Fibrous materials Asbestoes and Erionite generation of ROS, physical interaction with the mitotic machinery and induction of a chronic inflammatory response, in addition to genetic and epigenic alterations.

C ARCINOGENIC AGENTS Infectious pathogens DNA tumor viruses and RNA tumor viruses a) Human papiloma virus- cervical cancer b) Barr- Virus- nasopharyngeial carcinoma c) Human T-cell lymphotropic virus type-1(HTLV-1) - acute T- cell Leukemia d) Helicobacter pylori - gastric cancer.

C ARCINOGENIC A GENTS Endogenous carcinogenic reactions Oxidative respiration and lipid peroxidation, two processes of normal cell metabolism, produce ROS that can react with DNA and lipids to produce oxidized products also seen by exposure to radiation.

Please Note this………. It is estimated that mutations occur in a single human cell per day. By and large, under normal circumstances, this immense error burden is successfully dealt with by the highly efficient cellular DNA repair mechanisms.

AGE- carcinogenic Factor Cancer, far from being a “modern” disease, is one of the oldest disease ever seen in human specimen- quite possibly the oldest. Cancer’s emergence in the world is the product of a double negative: it becomes common only when all other killers themselves have been killed.

D RIVERS OF C ANCER Proto-oncogenes Tumor suppressor genes

P ROTO - ONCOGENES Proto oncogenes code for proteins that help regulate cell growth. A change in the DNA sequence of the proto - oncogene gives rise to an oncogene Example: Ras, v- src,

T UMOR S UPPRESSOR GENES Slow down cell division Repair DNA mistakes Tell cells when to die APOPTOSIS Examples: Retinoblastoma protein (pRb) in human retinoblastoma; Tumor protein p53, BRCA1 etc

THE THEORY OF CANCER DNA mutations Translocations Deletions Inversions Addition or duplication Substitution The genetic changes

E XAMPLES OF MUTATIONS Sequence1Sequence 2Type ACTCGTTAGGCA SUBSTITUTION ACTCGTTAGGCAACTCGGCA DELETION ACTCGTTAGGCA ACTCGTTATCAGGCA INSERTION ACTCGTTAGGCA ACTTGCTAGGCA INVERSION ACTCGTTAGGCA DUPLICATION ACTCCTTAGGCA ACTCGTTAGTTAGGCA

G ENERAL TREATMENT INFORMATION ABOUT CANCER The cancer cure includes only two principles- the removal and destruction of diseased tissue. a choice between the hot ray and the cold knife

T REATMENT M ETHODS Surgery Radiation Therapy Chemotherapy Induction Consolidation Maintenance Targeted Therapy Hormonal Therapy

P REVENTION IS B ETTER THAN C URE Reduced tobacco consumption (all forms) A healthy life style Food Excercises Avoidance of alcohol Vaccination strategies Use your cell phone only for short calls or texts

WHAT WE CAN DO? Be a part of World Cancer Day 4 th February from WE CAN I CAN

C HALLENGES Proper funding The cause of cancer may vary from one person to other Lack of patients to undergo clinical trials

WE CAN Inspire action, Take action Prevent Cancer Challenge Perceptions Create Healthy environment Improve access to cancer care Build a quality cancer workforce Work together for increased impact Make the case for investing in cancer control

I CAN Make healthy lifestyle choices Understand that early detection saves lives Ask for support Support others Take control of many cancer journey Love, and be Loved Return to work Shape my story and speak out

THANK YOU