Introduction to Gene Expression Chapter 8 Sections 4 & 5.

Slides:



Advertisements
Similar presentations
3.4: Transcription and Translation
Advertisements

Bellwork: Place DNA Molecule in the collection folder.
RIBONUCLEIC ACID (RNA) HOW IS RNA DIFFERENT FROM DNA??HOW IS RNA DIFFERENT FROM DNA??
Unit 4 Part I Transcription.
Nucleic Acids DNA vs. RNA
The Structure of RNA RiboNucleic Acid
Nucleic Acids & Proteins Units 5 & 6. Nucleic Acids Nucleic Acids are Polymers made of Nucleotides 3 Parts: a)Phosphate group b)5-Carbon Sugar c)Nitrogen.
Section 2 From DNA to Protein
DNA & RNA + PROTEIN SYNTHESIS.  DNA (Deoxyribonucleic acid) is the code inside all living organisms.  The first model of DNA was built by Watson & Crick.
DNA AND PROTEIN SYNTHESIS DNA (DEOXYRIBONUCLEIC ACID) Nucleic acid that composes chromosomes and carries genetic information.
From Gene to Protein. DNA Review n Is made of nucleotides. n Contains deoxyribose sugar n Thymine, Guanine, Cytosine, Adenine n Is a double stranded molecule.
DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.
RNA Ribonucleic acid single stranded also made of nucleotides.
DNA Notes DAY 2 Replication, overview of transcription, overview of translation WARM UP What is the base pairing rule? Who created it?
DNA Chapter 12. DNA DeoxyriboNucleic Acid Sugar = deoxyribose Adenine + Thymine Guanine + Cytosine Double-stranded helix with alternating sugars and phosphate.
Chapter 12 – DNA and Proteins DNA Structure: DNA is made of many smaller subunits called nucleotides.
Chapter 12 Making Proteins. Differences between RNA and DNA DNA = double strand; RNA = single strand RNA contains Ribose instead of deoxyribose. RNA uses.
Chapter From DNA to Protein.
DNA and RNA Objectives: 8.0 Identify the structure and function of DNA, RNA, and protein. 8.1 Explaining relationships among DNA, genes, and chromosomes.
RNA and Protein Synthesis. Write these terms in your journal Ribosome — makes proteins Ribosome — makes proteins RNA polymerase — enzyme that puts together.
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
RNA Structure and Protein Synthesis Chapter 10, pg
DNA Unit Target: Explain why individuals of the same species vary in how they look, function and behave.
RNA (ribonucleic acid) – single stranded nucleotide chain – ribose sugar – G-C and A-U – Uracil instead of Thymine – Different types: – mRNA, tRNA, rRNA.
How does DNA control cell activities?. Protein Production The sequence of nucleotides in DNA contains instructions for producing proteins. The sequence.
DNA, RNA, & Protein Synthesis
RNA AND PROTEIN SYNTHESIS
DNA The Code of Life.
DNA to Protein Transcription & Translation.  What are these nucleotides telling us?  Sequence of nucleotides in DNA contains information to produce.
RNA and Protein Synthesis Mr. Cobb GCA Fall 2011.
Protein Synthesis: Protein Synthesis: Translation and Transcription EQ: What is the Central Dogma and what processes does it involve? Describe processes.
8.2 Structure of DNA KEY CONCEPT DNA structure is the same in all organisms.
The student is expected to: 4B investigate and explain cellular processes, including homeostasis, energy conversions, transport of molecules, and synthesis.
Structure of DNA DNA is made up of a long chain of nucleotides
DNA mRNA Transcription Chapter 8 The Central Dogma of Molecular Biology Cell Polypeptide (protein) Translation Ribosome.
RNA (ribonucleic acid)
RNA & Protein Synthesis
Cell Controls How does a cell control its processes?
DNA, RNA, and Protein Synthesis
8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.
Chapter 10: Nucleic Acids and Protein Synthesis. DNA DNA (Deoxyribonucleic acid) –Stores and transmits genetic information –Double stranded molecule (looks.
Chapter 13: RNA and Protein Synthesis Mr. Freidhoff.
Molecular Genetics Molecular Genetics. Question??????? What IS a gene or trait? In the case above, what are freckles? What IS a gene or trait? In the.
What is the ultimate job of the cell?. TO MAKE PROTEINS!
8.3 DNA Replication KEY CONCEPT DNA replication copies the genetic information of a cell.
Transcription & Translation. Objectives: Relate the concept of the gene to the sequences of nucleotides in DNA Sequence the steps involved in protein.
8.2 KEY CONCEPT DNA structure is the same in all organisms.
Protein Synthesis DNA&RNA DNA Deoxyribonucleic Acid Deoxyribonucleic Acid Shape - double helix - twisted ladder Shape - double helix - twisted ladder.
Nucleic Acids and Protein Synthesis How we make the proteins that our body is made of.
What is a genome? The complete set of genetic instructions (DNA sequence) of a species.
Nucleic Acid and Protein Synthesis
DNA song
Chapter 4: DNA Replication, Protein synthesis, & Recombinant dNA
RNA Another Nucleic Acid.
Protein Synthesis.
Why do we use mice to conduct medical experiments?
Protein synthesis: Overview
RNA is a nucleic acid made of linked nucleotides.
Review.
Transcription/ Translation Notes 16-17
RNA is a nucleic acid made of linked nucleotides.
7.3 RNA and Protein Synthesis
Nucleic Acids And Protein Synthesis
DNA Transcription and Translation
Transcription & Translation
Protein Synthesis.
Protein Synthesis.
DNA and RNA.
DNA, RNA, and Protein Synthesis
Presentation transcript:

Introduction to Gene Expression Chapter 8 Sections 4 & 5

RNA Structure How is RNA different from DNA?

DNA (deoxyribonucleic acid) Contains the sugar DEOXYRibose ADENINEADENINE pairs with Thymine GUANINE pairs with Cytosine Double Stranded

RNA (ribonucleic acid) Contains the sugar Ribose adenine uraciladenine pairs with uracil GUANINE pairs with Cytosine Single Stranded

Is uracil a purine or a pyrimidine? How do you know? pyrimidine It has to be the same as thymine

Fill in Your Chart… Table 1. Differences Between DNA and RNA: DNARNA SUGAR DeoxyriboseRibose NITROGEN BASES A-T, G-CA-U, G-C SHAPE Double helixSingle strand

Let’s Practice: DNA Replication (Review) Strand 1 (old strand) Strand 2 (new strand) ATGCCAATATGCCAATTACGGTTA

RNA Synthesis (Transcription) DNA Template Strand RNA Sequence ATGCCAATATGCCAATUACGGUUA (Section 8.4)

Compare Strand 2 (the new strand you wrote the sequence for) in DNA Replication to the RNA sequence that resulted from RNA synthesis. What do you notice? The strands are identical except that in the RNA sequence resulting from transcription have uracil (U) instead of thymine (T)

Where in the cell does RNA synthesis occur? The nucleus What is RNA synthesis actually called? Transcription

What happens to the DNA molecule that was unzipped so that RNA synthesis (transcription) could occur? The double helix closed back up and it is still in the nucleus for use by the cell

Where does the RNA molecule that was just made go now? Into the cytoplasm How does it get out of the nucleus? Through a nuclear pore

Central Dogma: information flows in one direction from DNA to RNA to proteins

RNA Function: Why is RNA important? What are the three types of RNA? messenger RNA or mRNA, transfer RNA or tRNA, and ribosomal RNA or rRNA

Fill in the blanks to describe the function of each of the 3 types of RNA. Messenger RNA (mRNA) transcribes the code from DNA and takes it from the nucleus into the cytoplasm at the ribosome. Transfer RNA (tRNA) translates the message by transferring amino acids from the cytoplasm to the ribosomes based on the instructions in the mRNA. Ribosomal RNA (rRNA) is a structural component of ribosomes that binds mRNA and tRNA together (most RNA in a cell is rRNA).

RNA contains the message from the DNA that is needed by the cell to make proteins

Proteins: WHAT ARE PROTEINS? Proteins are organic compounds (compounds that contain carbon) that are made from amino acids (aa or AA) linked together by a type of covalent bond called a peptide bond. ex. AA 1 + AA 2 + AA 3 = a protein/polypeptide

WHY ARE PROTEINS IMPORTANT? help build cell organelles (found in the membranes)help build cell organelles (found in the membranes) are used as enzymes to promote reactionsare used as enzymes to promote reactions are found in muscles (actin & myosin), blood (hemoglobin), insulin, and antibodies, as well as hair, silk, and other body structures (skin, bones, ligaments, tendons, etc.)

How are proteins made? Proteins are made in the process of protein synthesis also called gene expression. There are two parts to this process: transcription and translation. These processes mainly occur in the G1 phase of Interphase in the Cell Cycle.

DNATransciption is when a molecule of DNA untwists and one strand is read to make a molecule of RNA. It occurs in the nucleus. Transcription: (Section 8.4)

Let’s “practice” transcription again. DNA 3’T A C G C T A G T C C G T C5’ mRNA 5’A U G C G A U C A G G C A G3’

Translation ( t RNA) Translation is when an mRNA molecule is “read” in the cytoplasm at a ribosome, and tRNA molecules bring amino acids in the order indicated by the nucleotide sequence of the mRNA molecule to be hooked together into a polypeptide (protein). (Section 8.5)

Here is a diagram showing translation. Write the number of the structure indicated in the diagram next to the correct name. amino acids anticodon mRNA polypeptide Ribosome 14325

Let’s practice translating a message Start by transcribing the DNA sequence given into a molecule of mRNA. Divide the mRNA into codons by drawing a line between every 3 nucleotides in the mRNA code. Then, write the anticodons that would be found on the corresponding tRNA molecule. Finally, use the codon chart to determine which amino acid is coded for by the sequence in the mRNA.

Codons in mRNA

DNA Sequence: T A C G G G T T C A A C T T G A C T A U G C C C A A G U U G A A C U G A (codons) U A C G G G U U C A A C U U G A C U (anticodons) Start/met pro lys leu asp stop Sequence: How many codons did you write? ____ How many anticodons did you write? How many anticodons did you write? ____ How many amino acids were coded for? (HINT: Stop is NOT an amino acid) ____ tRNA Sequence: mRNA Sequence: Amino Acid

Overview of Protein Synthesis (Gene Expression) What are the structures labeled 1 & 2? 1. Nucleus or nuclear envelope & 2. cytoplasm 2

This diagram shows only 1 ribosome translating the message from the mRNA into the polypeptide (amino acid sequence). Is this accurate? Explain. Hundreds of ribosomes translate the mRNA at the same time so that there is time for the process to finish 2 No

2

2

If red flowers are RR or Rr and white flowers are rr, explain why these two alleles are EXPRESSED differently. The R allele codes for a protein that is a red pigment while the r allele does not code for the synthesis of any molecule 2

On the lines in this box, write WHERE in the cell each process occurs. Be specific. _________________ _________________ _________________ ______________________ ______________________ ______________________

On the lines in this box, write WHERE in the cell each process occurs. Be specific. _________________ ___ nucleus ______ _________________ ______________________ ____ cytoplasm at a__ _____ribosome ______