S. pombe Unicellular archiascomycete Diverged from S. cerevisiae 330- 1144 Ma Size ~14 Mb, 3 chromosomes No synteny Data stored in GeneDB.

Slides:

Advertisements

Similar presentations

1 Orthologs: Two genes, each from a different species, that descended from a single common ancestral gene Paralogs: Two or more genes, often thought of.

Advertisements

European Bioinformatics Institute The Gene Ontology Annotation (GOA) Database and enhancement of GO annotations through InterPro2GO Nicky Mulder

Ontology annotation: mapping genomic regions biological function Paul D Thomas, Huaiyu Mi and Suzanna Lewis.

Basics of Comparative Genomics Dr G. P. S. Raghava.

Comparative genomics Joachim Bargsten February 2012.

The design, construction and use of software tools to generate, store, annotate, access and analyse data and information relating to Molecular Biology.

Systems Biology Existing and future genome sequencing projects and the follow-on structural and functional analysis of complete genomes will produce an.

Introduction of bioinformatics and Biological Database 高雄醫學大學生物醫學暨環境生物學系助理教授張學偉 2006/08/08.

COG and GO tutorial.

Models of sequence evolution Chap. 4 Higgs and Attwood.

Today’s menu: -UniProt - SwissProt/TrEMBL -PROSITE -Pfam -Gene Onltology Protein and Function Databases Tutorial 7.

Sequence-Structure-Function Sequence Structure Function Threading Ab initio BLAST Folding: impossible but for the smallest structures Function prediction.

Today’s menu: -UniProt - SwissProt/TrEMBL -PROSITE -Pfam -Gene Onltology Protein and Function Databases Tutorial 7.

Today’s menu: -SwissProt/TrEMBL -PROSITE -Pfam -Gene Onltology Protein and Function Databases Tutorial 7.

EBI is an Outstation of the European Molecular Biology Laboratory. UniProt Jennifer McDowall, Ph.D. Senior InterPro Curator Protein Sequence Database:

Protein and Function Databases

Today’s menu: -UniProt - SwissProt/TrEMBL -PROSITE -Pfam -Gene Onltology Protein and Function Databases Tutorial 7.

Predicting Function (& location & post-tln modifications) from Protein Sequences June 15, 2015.

DEMO CSE fall. What is GeneMANIA GeneMANIA finds other genes that are related to a set of input genes, using a very large set of functional.

An introduction to using the AmiGO Gene Ontology tool.

BTN323: INTRODUCTION TO BIOLOGICAL DATABASES Day2: Specialized Databases Lecturer: Junaid Gamieldien, PhD

PAT project Advanced bioinformatics tools for analyzing the Arabidopsis genome Proteins of Arabidopsis thaliana (PAT) & Gene Ontology (GO) Hongyu Zhang,

Functional Linkages between Proteins. Introduction Piles of Information Flakes of Knowledge AGCATCCGACTAGCATCAGCTAGCAGCAGA CTCACGATGTGACTGCATGCGTCATTATCTA.

Using The Gene Ontology: Gene Product Annotation.

Chapter 26: Phylogeny and the Tree of Life Objectives 1.Identify how phylogenies show evolutionary relationships. 2.Phylogenies are inferred based homologies.

Fission Yeast Computing Workshop -1- Searching, querying, browsing downloading and analysing data using PomBase Basic PomBase Features Gene Page Overview.

20.1 Structural Genomics Determines the DNA Sequences of Entire Genomes The ultimate goal of genomic research: determining the ordered nucleotide sequences.

DONNA MAGLOTT, PH.D. PRO AND MEDICAL GENETICS RESOURCES AT NCBI.

Web Apollo and the VectorBase user community Gloria I. Giraldo-Calderón March 31, 2015.

Anatomy of a Genome Project A.Sequencing 1. De novo vs. ‘resequencing’ 2.Sanger WGS versus ‘next generation’ sequencing 3.High versus low sequence coverage.

A Comparative Genomic Mapping Resource for Grains.

Ontologies GO Workshop 3-6 August Ontologies  What are ontologies?  Why use ontologies?  Open Biological Ontologies (OBO), National Center for.

Monday, November 8, 2:30:07 PM  Ontology is the philosophical study of the nature of being, existence or reality as such, as well as the basic categories.

Manual GO annotation Evidence: Source AnnotationsProteins IEA:Total Manual: Total

Introduction to the GO: a user’s guide Iowa State Workshop 11 June 2009.

24th Feb 2006 Jane Lomax GO Further. 24th Feb 2006 Jane Lomax GO annotations Where do the links between genes and GO terms come from?

Fission Yeast Computing Workshop -1- Getting the most from the fission yeast genome data: A computing workshop WT Sanger Institute WT Genome Campus Hinxton.

PIRSF Classification System PIRSF: Evolutionary relationships of proteins from super- to sub-families Homeomorphic Family: Homologous proteins sharing.

Protein and RNA Families

Getting Started: a user’s guide to the GO GO Workshop 3-6 August 2010.

Functional Annotation and Functional Enrichment. Annotation Structural Annotation – defining the boundaries of features of interest (coding regions, regulatory.

1 Gene function annotation. 2 Outline  Functional annotation  Controlled vocabularies  Functional annotation at TAIR  Resources and tools at TAIR.

Other biological databases and ontologies. Biological systems Taxonomic data Literature Protein folding and 3D structure Small molecules Pathways and.

Getting Started: a user’s guide to the GO TAMU GO Workshop 17 May 2010.

Copyright OpenHelix. No use or reproduction without express written consent1.

Rice Proteins Data acquisition Curation Resources Development and integration of controlled vocabulary Gene Ontology Trait Ontology Plant Ontology

Generic Database. What should a genome database do? Search Browse Collect Download results Multiple format Genome Browser Information Genomic Proteomic.

Genome annotation and search for homologs. Genome of the week Discuss the diversity and features of selected microbial genomes. Link to the paper describing.

Introduction to the GO: a user’s guide NCSU GO Workshop 29 October 2009.

Update Susan Bridges, Fiona McCarthy, Shane Burgess NRI

The evolution of the immune system in chicken and higher Organon, Oss Tim Hulsen.

EBI is an Outstation of the European Molecular Biology Laboratory. UniProtKB Sandra Orchard.

InterPro Sandra Orchard.

Tools in Bioinformatics Ontologies and pathways. Why are ontologies needed? A free text is the best way to describe what a protein does to a human reader.

Gene Ontology TM (GO) Consortium

Welcome to the Protein Database Tutorial. This tutorial will describe how to navigate the section of Gramene that provides collective information on proteins.

Gene3D, Orthology and Homology-Based Inheritance of Protein-Protein Interactions Corin Yeats

Sequence-Structure-Function Sequence Structure Function Threading Ab initio BLAST Folding: impossible but for the smallest structures Function prediction.

The Integrated Microbial Genome (IMG) systems

Annotating with GO: an overview

Introduction to the Gene Ontology

Basics of Comparative Genomics

Sequence based searches:

Department of Genetics • Stanford University School of Medicine

Functional Annotation of the Horse Genome

Genome Annotation Continued

Overview Gene Ontology Introduction Biological network data

Strategies for annotation of a genome

A User’s Guide to GO: Structural and Functional Annotation

Basics of Comparative Genomics

Presentation transcript:

S. pombe Unicellular archiascomycete Diverged from S. cerevisiae Ma Size ~14 Mb, 3 chromosomes No synteny Data stored in GeneDB

Nomenclature Evolutionary relationships (orthology, paralogy, protein family and domain) Functional annotation (Using GO, from literature curation, functional transfer from orthologs, inferred electronically from protein family/domain) Genetic mapping data (minimal, small amount, mostly linked to physical sequence data) Areas of interest

Areas of expertise/collaborations Literature curation Ontology development (GO consortium) Ortholog/paralog resolution (and functional inference) Protein family identification (Pfam/Interpro) Functional mappings (e.g. Interpro2GO) Physical and genetic interactions (GO & BioGRID consortiums) Functional prediction (Daniel Barker)

Orthologs Sequence and annotation updates GO curation GO associations Domain /family Family identification Dataflow Links Interpro2Go GOA SPKW2GO User submission Sequence analysis Literature curation Data mining

Biological process Cellular component Molecular function Gene count 4990 Dubious 67 No GO S. pombe % (c.f. S. cerevisiae %)

GO terms S. cerevisiae orthologs Pfam families ** Submitted to Pfam ** DUF mainly eukaryotic/fungal No orthologs Of which 74 No S. cerevisiae ortholog Gene count 4990 Unassigned 456 Dubious 67 Conserved 57 No GO/Pf/Ort 341 ** Distant ortholog detection Pfam coverage S. pombe 75% c.f.S. cerevisiae 65%