Supp Fig. 1. Protein numberScores (>28=p<0.05)Name of peptide GINumber 11148myosin, heavy polypeptide 4, skeletal muscle67189167 2682myosin, heavy polypeptide.

Slides:

Advertisements

Similar presentations

Additional File 7 K-means cluster graphs (15 clusters)

Advertisements

Definition: Proteins are macromolecules with a backbone formed by polymerization of amino acids. Proteins carry.

Structure of Skeletal Muscle Presentation by: Angela Holloman.

Contraction of Skeletal Muscle Arsalan Yousuf

Muscle Specialized for: Types:.

Chapter 3 Energy Metabolism and Metabolic Adaptations to Training.

Mitochondria. Mitochondrial Structure (cont.) Mitochondrial Structure.

Gluconeogenesis (formation of new sugar) 1. Why gluconeogenesis?

MUSCLES % of body mass only system converting chemical energy into mechanical 2 types -skeletal (striated) -smooth.

Sliding Filament Theory

Contraction of Skeletal Muscle Arsalan Yousuf

Sensory & Motor Mechanisms

Myosin is a motor that runs along (or tugs at) actin. Actin-based movement of vesicles Chromosome migration Myosin-driven cell shape changes Muscle contraction.

How Cells make ATP: Energy-Releasing Pathways

Fiber Types Three fiber typing schemes – Metabolic/biochemical activity of fiber – Protein/gene expression of fiber – Functional performance of motor unit.

1 SURVEY OF BIOCHEMISTRY Glycolysis. 2 Announcements Exam #2 on June 26 –Chapters 7, 8, 11, 12, 14 Bring calculators Study Session with Vonda –Thursday,

MITOCHONDRIAL GENETICS. Origin of Mitochondria Endosymbiont Theory Similar size to certain free-living bacteria Similar chromosome & cytoplasm to bacteria.

Pages Molecular Motors. General Characteristics of Molecular Motors Motor proteins – bind to a polarized cytoskeletal filament and use the energy.

Molecules of Life Chapter 2. Protein Functions  Act as enzymes  Structural- cytoskeleton (actin, tubulin, others)  Mechanical- actin and myosin in.

Cellular Respiration (Chapter 9). Energy source Autotrophs: Producers Plants, algae and some bacteria Make own organic molecules Heterotrophs: Consumers.

Figure S1 and Table S1 Exposure of human monocytes to oxLDL leads to rapid changes in proteins phosphorylation status Human monocytes treated for 5,15.

Exon 2 Exon 3 STOP K8β intron Figure S1 …acacaagacagcugcagcag GUAUAGACGGGAAACAGGUGUCUAUCUUGGCCGGCUGGUUACUCAAAUGGGAACAAUGGCGCCACCUUGCUGUCUUUGUAG gcauuagaagaaaaggaugc…

Cellular Respiration (Chapter 9). Energy Plants, algae & some bacteria Convert radiant energy (sun) into chemical energy (glucose)

Dr.S.Chakravarty, MD. Oxidation is defined as the removal of electrons and reduction as the gain of electrons. Oxidation is always accompanied by reduction.

Visceral Muscle. How is the gut organized anatomically?

Muscles. Smooth muscle Found in the walls of hollow organs and the blood vessels Lack striations Contain less myosin Cannot generate as much tension as.

Muscle Tissue Function Essentials Ch 16 p

The Cell Cytoskeleton1 Chapter 17 Questions in this chapter you should be able to answer: Chapter 17: , Watch this animation

Light energy ECOSYSTEM Photosynthesis in chloroplasts CO 2 + H 2 O Cellular respiration in mitochondria Organic molecules + O 2 ATP powers most cellular.

3 Types of Muscle Tissue Properties of Muscle Tissue

Complete list of LC-MS myc interating protiens in the MCF7 cells, proteins highlighted in red are those differentially expressed from the LCC1 and LCC1.

Fig. 9-1 Chapter 9 Cellular Respiration: Harvesting Chemical Energy.

Draw a reaction map of glucose completely metabolized to CO 2 + H 2 O in the presence of oxygen25 Points Reference:

Skeletal Muscle Microscopic Anatomy Chapter 10. Microscopic Anatomy Muscle fibers = muscle cells: long and multinucleate Sarcolemma: cell membrane myoglobinSarcoplasm:

Lactate Lactate dehydrogenase Pyruvate + NADH ATP Pyruvate carboxylase ADP Oxaloacetate GTP phosphoenolpyruvate carboxykinase GDP Phosphoenol pyruvate.

P41273 – Tumor necrosis factor ligand superfamily member 9 (Reverse assay) ° - H 2 O loss; * - NH 3 loss.

Molecular Basis of Muscle Contraction Standard 9 h. Students know the cellular and molecular basis of muscle ocntraction,including the roles of actin,

Skeletal Muscle Physiology Muscle excitation and energy sources. Describe the roles of ATP in muscle function. Explain the sources of ATP for muscle function.

Muscle voluntary, striated involuntary, striated auto-rhythmic involuntary, non-striated evolved first multi-nucleated digestive system arteries, veins.

Muscle Structure Muscle Contract- ion Neuro- muscular Junction Muscle Mechanics Muscle Energectics Muscle Perform- ance

Supp table 1: Gene sets differentially expressed in Angpt-1 high MDS samples No.Gene Set NameGenes 1KEGG_CELL_CYCLE cyclin-dependent kinase 1, E2F transcription.

Supplementary Material

Muscle contraction.

B. A. Pedersen, P. G. Yazdi, J. F. Taylor, O. S. Khattab, Y. -H

Chapter 6 Protein Function.

Aerobic Cellular Respiration

The Structure of Skeletal Muscle

DR. AYISHA QURESHI ASSISTANT PROFESSOR MBBS, MPhil

Nerve MUSCLE PHYSIOLOGY

Metabolism 1: Catabolism

3 Types of Muscle Tissue Properties of Muscle Tissue

F. Electron Transport Chain [ETC]

Study of the SV2A protein role in Epilepsy.

Small molecules that perturb the function of their targets on fast time scales can be powerful probes of dynamic cellular processes, such as intracellular.

Glycolysis occurs in the cytoplasm and has two major phases:

Muscle and Muscle Contraction

Cellular Respiration Video

Pyruvate Dehydrogenase

Organic Compounds (Cont.) Proteins and Nucleic Acids

Metabolic reprogramming in the hypoxic microenvironmentThis figure shows the metabolic processes that are upregulated in response to hypoxia and the therapeutic.

Fig. 9-1 Figure 9.1 How do these leaves power the work of life for the giant panda?

Acetyl-CoA Succinyl-CoA

Energy review Chapters 8-10.

Myoglobin is expressed in oxidative skeletal myofibers.

Energy Conversion: Mitochondria and ATP Production.

Major pathways of compartmentalized energy metabolism in bloodstream (a) and procyclic (b) life cycle stages of the flagellated and fully oxygen-dependent.

Carbohydrate transport and phosphorylation by the PTS and their coupling to glycolysis. Carbohydrate transport and phosphorylation by the PTS and their.

Presentation transcript:

Supp Fig. 1

Protein numberScores (>28=p<0.05)Name of peptide GINumber 11148myosin, heavy polypeptide 4, skeletal muscle myosin, heavy polypeptide 8, skeletal muscle, perinatal myosin, heavy polypeptide 1, skeletal muscle, adult myosin, heavy polypeptide 2, skeletal muscle, adult desmin alpha-cardiac actin gamma-actin Myh7 protein alpha cardiac myosin heavy chain fast skeletal myosin alkali light chain 1 isoform 1f myosin, heavy polypeptide 13, skeletal muscle glyceraldehyde-3-phosphate dehydrogenase muscle embryonic myosin heavy chain ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform ATP synthase beta-subunit PREDICTED: similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) muscle creatine kinase tropomyosin 2, beta spermatid-specific alpha-tropomyosin ATPase, Ca++ transporting, fast twitch filamin C, gamma heat shock protein HSP parvalbumin PREDICTED: similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) H3 histone, family 3A albumin fructose-bisphosphate aldolase A TI mCG elongation factor 1alpha enolase 3, beta muscle elongation factor Histone H2A PDZ-LIM protein cypher1c (ZASP) PDZ and LIM domain protein M2-type pyruvate kinase RecName: Full=Titin; AltName: Full=Connectin sarcalumenin Chain A, Crystal Structure Of Macrophage Migration Inhibitory Factor Complexed With (E)-2-Fluoro-P-Hydroxycinnamate myosin light chain, phosphorylatable, fast skeletal muscle tubulin, beta, tubulin, beta tubulin, beta tubulin, beta fast skeletal muscle troponin C tubulin beta-1 chain - mouse heat shock protein 70 cognate RecName: Full=Hemoglobin subunit alpha; AltName: Full=Hemoglobin alpha chain; AltName: Full=Alpha-globin S ribosomal protein pro-alpha-2(I) collagen phospholipase c cytochrome c oxidase subunit Va preprotein Hspa8 protein reductase superfamily containing protein malate dehydrogenase Supplementary Material List 1: Proteins identified in purified aggregates

Proteinscore (>27=p<0.05)Name of peptideGI Number 11538myosin, heavy polypeptide 4, skeletal muscle myosin, heavy polypeptide 1, skeletal muscle, adult myosin, heavy polypeptide 2, skeletal muscle, adult Myosin, heavy polypeptide 8, skeletal muscle, perinatal myosin, heavy polypeptide 8, skeletal muscle, perinatal tropomyosin 2, beta myosin, heavy polypeptide 7, cardiac muscle, beta alpha-cardiac actin alpha-tropomyosin myosin, heavy polypeptide 13, skeletal muscle actin, beta, cytoplasmic muscle creatine kinase mCG140437, isoform CRA_a fructose-bisphosphate aldolase A fast skeletal myosin alkali light chain 1 isoform 1f ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform ATPase, Ca++ transporting, fast twitch adenine nucleotide translocase glyceraldehyde-3-phosphate dehydrogenase parvalbumin desmin Atp5b protein actinin alpha enolase 3, beta muscle phosphoglycerate mutase ATP synthase beta-subunit M-protein PREDICTED: similar to Glyceraldehyde-3- phosphate dehydrogenase (GAPDH) myosin light chain, phosphorylatable, fast skeletal muscle ATP synthase, H+ transporting, mitochondrial F1F0 complex, subunit e fast skeletal muscle troponin C myoglobin RecName: Full=Hemoglobin subunit alpha; AltName: Full=Hemoglobin alpha chain; AltName: Full=Alpha-globin spermatid-specific troponin T RecName: Full=Neuronal cell adhesion molecule; Short=Nr-CAM; AltName: Full=NgCAM-related cell adhesion molecule; Short=Ng myozenin TAFI transmembrane protein TM9SF alpha-fetoprotein PREDICTED: similar to Glyceraldehyde-3- phosphate dehydrogenase Supplementary Material List 2: Proteins identified in purified aggregates