Atttgaaatgaaggcagaaaccaggcttaaacaaagactgaaactcattctcttttcaaa tctcctgccgataaacatatgtgcccagtcttttgtttcccagacatcaggtttccatta tttaaacagagcttctacctggatctgtcaagagcatgaggcagacatatttaagatttt.

Slides:



Advertisements
Similar presentations
Abstract Tight junctions are intercellular adhesion complexes that connect epithelial cells and thus prevent leakage between cells. They are made of tight.
Advertisements

Yan Wu, Xiangru Lu, Fuli Xiang, and Qingping Feng
Table S1. Features of patients with acute myocardial infarction or unstable angina and control subjects parametersHealthy controlsUnstable anginaAMIP value.
Supplemental Results Online Figure S1. Norepinephrine increases ROS production. (A): H9c2 cells were treated with 10  M norepinephrine and intracellular.
Tight junctions are intercellular adhesion complexes that connect epithelial cells and thus prevent leakage between cells. They are made of tight junction.
Date of download: 5/30/2016 Copyright © The American College of Cardiology. All rights reserved. From: Transcriptome Characterization of Estrogen-Treated.
Date of download: 7/9/2016 Copyright © The American College of Cardiology. All rights reserved. From: Fibroblast growth factor-1 improves cardiac functional.
IL-18 Downregulates Collagen Production in Human Dermal Fibroblasts via the ERK Pathway  Hee Jung Kim, Seok Bean Song, Jung Min Choi, Kyung Moon Kim,
Fig. 1. Timeline: Adult (6-month-old) and old (22-month-old) rats were ovariectomized. Half of the animals received immediate E2 replacement.
Cardioprotective Effect of a Hemoglobin-Based Oxygen Carrier on Cold Ischemia/Reperfusion Injury Cardiology 2011;120:73–83 - DOI: / Fig.
Marcello Arsura, Min Wu, Gail E Sonenshein  Immunity 
Cardiac-Specific Overexpression of HIF-1α Prevents Deterioration of Glycolytic Pathway and Cardiac Remodeling in Streptozotocin-Induced Diabetic Mice 
Figure 3. Activation of Wild-Type and Point-Mutated MMP-9 Promoter Constructs by IL-1β A, Schematic representation of the different 1.3-kb MMP-9-luciferase.
Intracellular Action of Matrix Metalloproteinase-2 Accounts for Acute Myocardial Ischemia and Reperfusion Injury by Wenjie Wang, Costas J. Schulze, Wilma.
by James A. Clemens, Diane T. Stephenson, E. Barry Smalstig, Eric P
Volume 134, Issue 4, Pages (April 2008)
Volume 118, Issue 4, Pages (April 2000)
TSLP Down-Regulates S100A7 and ß-Defensin 2 Via the JAK2/STAT3-Dependent Mechanism  Hana Lee, Woo-In Ryu, Hee Joo Kim, Hyun Cheol Bae, Hwa Jung Ryu, Jung.
Constitutive and tumor necrosis factor-α-induced activation of nuclear factor-κB in adenomyosis and its inhibition by andrographolide  Bin Li, M.S., Ming.
Volume 104, Issue 3, Pages (September 1993)
Volume 80, Issue 8, Pages (October 2011)
Zara E Khan, Timothy C Wang, Guanglin Cui, Alfred L Chi, Rod Dimaline 
Substance P Enhances the Production of Interferon-induced Protein of 10 kDa by Human Keratinocytes in Synergy with Interferon-γ  Naoko Kanda, Shinichi.
Volume 6, Issue 2, Pages (February 1997)
Preconditioning protects the severely atherosclerotic mouse heart
Volume 62, Issue 2, Pages (August 2002)
Volume 136, Issue 5, Pages (May 2009)
Istvan Arany, Judit K. Megyesi, Jane E.B. Reusch, Robert L. Safirstein 
Volume 16, Issue 6, Pages (December 2004)
Cytokines Link Toll-Like Receptor 4 Signaling to Cardiac Dysfunction After Global Myocardial Ischemia  John Cha, MD, Zhiping Wang, MD, Lihua Ao, BS, Ning.
Volume 54, Issue 1, Pages (July 1998)
Volume 68, Issue 3, Pages (September 2005)
Long-term exposure to high altitude hypoxia during pregnancy increases fetal heart susceptibility to ischemia/reperfusion injury and cardiac dysfunction 
Heike A. Hildebrandt et al. BTS 2016;1:3-13
a b AP-1 Sp1 Nuclear extract Competitor (100X) CDCA 50 µM + - M
A C Segment 1 Segment B Segment 4 D 5 3
Cardioplegia and Diazoxide Modulate STAT3 Activation and DNA Binding
Potent adenylate cyclase agonist forskolin restores myoprotective effects of ischemic preconditioning in rat hearts after myocardial infarction  Shigetoshi.
Oral pretreatment with a green tea polyphenol for cardioprotection against ischemia– reperfusion injury in an isolated rat heart model  Shigeki Yanagi,
Volume 62, Issue 3, Pages (September 2002)
Volume 60, Issue 3, Pages (September 2001)
Volume 45, Issue 1, Pages (January 2012)
Kourosh Baghelai, MDa, Laura J. Graham, BSa, Andrew S
Volume 73, Issue 7, Pages (April 2008)
Histamine Enhances the Production of Granulocyte-Macrophage Colony-Stimulating Factor via Protein Kinase Cα and Extracellular Signal-Regulated Kinase.
Histamine Inhibits the Production of Interferon-induced Protein of 10 kDa in Human Squamous Cell Carcinoma and Melanoma  Naoko Kanda, Shinichi Watanabe 
Noritaka Oyama, Keiji Iwatsuki, Yoshimi Homma, Fumio Kaneko 
Naoko Kanda, Shinichi Watanabe  Journal of Investigative Dermatology 
Courtney N. Zeller, Yue Wang, PhD, Troy A
Estradiol suppresses type I collagen synthesis in mesangial cells via activation of activator protein-1  Sharon Silbiger, Jun Lei, Joel Neugarten  Kidney.
Bradykinin pretreatment improves ischemia tolerance of the rabbit heart by tyrosine kinase mediated pathways  Jun Feng, MD, PhD, Eliot R Rosenkranz, MD 
Ketoconazole Suppresses Prostaglandin E2-Induced Cyclooxygenase-2 Expression in Human Epidermoid Carcinoma A-431 Cells  Naoko Kanda, Dr., Shinichi Watanabe 
Volume 65, Issue 3, Pages (March 2004)
Controlled hyperkalemic reperfusion with magnesium rescues ischemic juvenile hearts by reducing calcium loading  Hajime Imura, MD, Hua Lin, MSc, Elinor.
IL-18 Downregulates Collagen Production in Human Dermal Fibroblasts via the ERK Pathway  Hee Jung Kim, Seok Bean Song, Jung Min Choi, Kyung Moon Kim,
Connective Tissue Growth Factor: Expression in Human Skin In Vivo and Inhibition by Ultraviolet Irradiation  Taihao Quan, Tianyuan He, Sewon Kang, John.
Volume 119, Issue 2, Pages (August 2000)
Volume 67, Issue 5, Pages (May 2005)
Shankha S Biswas, Edward P Chen, Hartmuth B Bittner, R
Marcello Arsura, Min Wu, Gail E Sonenshein  Immunity 
IFN-γ Represses IL-4 Expression via IRF-1 and IRF-2
Lawrence M. Pfeffer, Andrzej T. Slominski 
Myeloid Differentiation Factor 88 Regulates Basal and UV-Induced Expressions of IL-6 and MMP-1 in Human Epidermal Keratinocytes  Youngae Lee, Hyunjung.
Figure 1 Empa and Cariporide effects during IR in insulin-perfused hearts. Hearts were subjected to IR and 1 µM Empa, ... Figure 1 Empa and Cariporide.
TNF Regulates the In Vivo Occupancy of Both Distal and Proximal Regulatory Regions of the MCP-1/JE Gene  Dongsheng Ping, Peter L. Jones, Jeremy M. Boss 
Expression of SENP2 mRNA is regulated by palmitate-induced NF-κB activation. Expression of SENP2 mRNA is regulated by palmitate-induced NF-κB activation.
Effects of an Angiotensin II Antagonist on Ischemic and Nonischemic Isolated Rat Hearts  Yosef Paz, Jacob Gurevitch, Inna Frolkis, Menachem Matsa, Amir.
Naoko Kanda, Shinichi Watanabe  Journal of Investigative Dermatology 
Volume 72, Issue 2, Pages (July 2007)
Bismarck Amoah-Apraku, Mao-Zhong Fang, Nicolas J. Guzman, M.D 
Presentation transcript:

atttgaaatgaaggcagaaaccaggcttaaacaaagactgaaactcattctcttttcaaa tctcctgccgataaacatatgtgcccagtcttttgtttcccagacatcaggtttccatta tttaaacagagcttctacctggatctgtcaagagcatgaggcagacatatttaagatttt tacaaaccggtgtatgagttaggtgagttttgcaaatgttcaaattcatttaatcaaaag aagcgctacaatgg tgtcct taatccttttatgattactgcaattttcagacaatatgaa caacacttattgcttctatatgctcttgtcttgtagcatttactttaatatcagtggaca gacagatatcactagtcatctgctgtttcttgagacatttgtaattttgtactctggtac acttctctctcct tgttct actgaaccccatacttacctacgaaaatactaagaacaaac atatgtattcctctgcttgcagcttgggaggcattatttattcaaatgacccaaagcttt taaagtcaatcttcaagttaaaaataaaaaaaaatggtactaccaa tgtacc acgccctg cttccttgaagaataggattcaggggaatcattgtaattgcacatctctttgttgtgttgt gggttgcttggttatcagcactaactgcagaaaatttcacgattctatatttctcttccc tgctttctgttttgctaatacattaaaaaaagaacacttttgcttgcatagcaaactttc ttcttctttgactcttttgcaatagcttgttaactgtccataacgaagactgtctgtaaa tgctgtatgtatcctctttgctgaacaaaaggtgaaacaaaaggatcagcaagcagggta gagattaaaacatatgagtcctggcaagagtttacttttgttgaaattcaca tgtcct ca taacagctatgggccccttgggaatttatttaaaatctgtcaccctgtgtttcctgaatc gtagattggcaataatattaatactttttagggcatgcgctgtgtgttaggcatcatttt cagtactctaaatataataattcatttgcttttagtaacttcatgatatgagtaactaat atccccatttctcagatgagaaagca gagaca agaagaaggcaagtcatgtgactccatt catagaactgagatgtggcttgtgaagccaagtgtttggccttcagaggccattgcttac cacttgctatggtgctctctgttgatctactgagcacacagtacttagtacaccattagg cacggagcacctgctgtcagctggtactgtccagtaccatcacctcgtatggactcatc catttttattttattttattttattttttttgctgctgctggctggtatgaagggg attgt tct tccacagaaaaggaaaaacagtcataacaatagcagcataatcatcctttaccttgt ctggtgtatatttgagctacagttgtgacagtcacatgaaaaagggcactacatggaact ttatttttgtcgtgacaaaattttatccttcttatcctcaaccttctagcagcagggcaa ctgaccaaaatggttcaaagtaaggtaaaaacttaaaagtcacagacgtcaagtagaatt gctaccattctttaataaacaatgttaaaaaatttaaaatgtactgaaagctgtaaaaga tgcttgtgaaccaactttgtactctttctagtccttaactgattttagaaagccaggatc agaaaaatagaaaaaaattctgctaaaaattatattcttctcttaaagaaagccacggag tttaaaactctctaacacatttgtggaaactttattttttttttgtttgagatttatttg aatgagctgttatgattggagacatgagaatttcagattaatgttttgcagccagaaaaa aaagccctctggaaagctggcaag tgttca taagtcagctccagaattatgtaggttgaa Ggctccccagtggacagagcgaata tataa gaaggaaaccagaggtctggtgc agttaca Tcccagagtct ggggatggagcg agcaca gaatt GRE1 GRE2 GRE3 GRE4 GRE5 GRE6 GRE7 GRE8 +1 Figure S1. Rat AT 2 R gene promoter sequence. The TATAA element is labeled in red. GREs are labeled in blue. Supplemental Results

8+ NE 1+ NE+C-CGRE 2+ NE+C-CGRE 1+ NE 2+ NE 6+ NE  3+ NE 3+ NE+C-3 3+ NE+C-CGRE 3+ NE+C-AGRE  5+ NE+C-CGRE 5+ NE+C-AGRE 6+ NE 5+ NE 7+ NE 7+ NE+C-CGRE 7+ NE+C-AGRE 8+ NE+C-CGRE 8+ NE+C-AGRE  4 4+ NE+C-4 4+ NE 6 6+ NE 6+ NE+C-6 4+ NE+C-AGRE 4+ NE 4+ NE+C-CGRE 6+ NE 6+ NE+C-CGRE 6+ NE+C-AGRECGRE+NE CGRE+NE+C-CGREAGRE+NE+C-AGRE AGRE+NE    Figure S2. Characterization of GREs in the AT 2 R promoter. EMSA was performed with nuclear extracts (NE) and biotin labeled ds-oligo probes containing GREs (1 through 8), and consensus GRE (CGRE), AT1aR-GRE (AGRE). C-3, C-4, C-6, C- CGRE, C-AGRE etc are cold ds-oligos used for competition experiments. Each EMSA generated band of same electrophoretic mobility as those of authentic GREs CGRE and AGRE, and competed out by homologous, heterlogous, and consensus oligos. GRE oligos used in EMSA GRE 1 (-1853)5’- CTACAATGGTGTCCTTAATCCTTTTA GRE 2 (-1674)5’-TCTCTCTCCTTGTTCTACTGAACCCC GRE 3 (-1526)5’-GTACTACCAATGTACCACGCCCTGCT GRE 4 (-1159)5’-GAAATTCACATGTCCTCATAACAGCT GRE 5 (-947)5’-TGAGAAAGCAGAGACAAGAAGAAGGC GRE 6 (-676)5’-ATGAAGGGGATTGTTCTTCCACAGAA GRE 7 (-107)5’-AGCTGGCAAGTGTTCATAAGTCAGCT GRE 8 (+13)5’-GGATGGAGCGAGCACAGAATTGAAAG Consensus GRE oligos used for heterologous competition in EMSA CGRE-S 5’-TATGGTTACAAACTGTTCTAAAAC CGRE-AS 5’-GTTTTAGAACAGTTTGTAACCATA AT1a-GRE-S 5’-AAGCTTGTACACTATTGTCTGAGTT AT1a-GRE-AS 5’-AACTCAGACAATAGTGTACAAGCTT

Figure S3. Effect of dexamethasone (Dex) on AT 2 R protein and mRNA abundance. Intact 17-day fetal hearts were treated with Dex for 48 hours in the absence or presence of RU 486. Data are mean  SEM. * P < 0.05 (t-test), treatment vs. control. n = 6.

MaleFemale Figure S4. Effect of AT 1 R and AT 2 R inhibitors on cardiac ischemia and reperfusion injury. Hearts were isolated from 3 month old male and female rats and were pretreated in the absence or presence of losartan (1 μM), or PD123,319 (PD, 0.3 μM), or losartan + PD for 5 min before subjecting to 20 min of ischemia and 30 min of reperfusion in a Langendorff preparation. Post- ischemic recoveries of left ventricle dP/dt max, dP/dt min, and end diastolic pressure (LVEDP) were determined. Data are mean  SEM. * P < 0.05 (2-way ANOVA), treatment vs. control. n = 5.

Figure S5. Rescue effect of PD123,319 on hypoxia-mediated ischemic vulnerability. Hearts were isolated from 3 month old male offspring that had been exposed to normoxia (control) or hypoxia before birth, and were treated in the absence or presence of PD123,319 (0.3 μM) for 5 min before subjecting to 20 min of ischemia and 30 min of reperfusion in a Langendorff preparation. Post-ischemic recovery of dP/dt max and dP/dt min were determined. Data are mean  SEM. Data were analyzed by two-way ANOVA. * P<0.05, hypoxia vs. control; † P<0.05, +PD123,319 vs. -PD123,319. n = 5