Supplemental Figure S1 ResidueMass Delta Mass Sequence Mascot Ion Score 62 - 701064.640.04R.DFGLLVFVR.K49 125 - 133994.680.04K.IPALDLLIK.L56 156 - 163939.550.04K.FYGELALK.K34.

Slides:

Advertisements

Similar presentations

Supplemental Figure 1 A No. at risk T T T

Advertisements

Figure 1.1 The observer in the truck sees the ball move in a vertical path when thrown upward. (b) The Earth observer views the path of the ball as a parabola.

Supplementary Figure 1. DAXX S564A does not change Mdm2/p53 stability or p53 ‑ mediated gene expression. (A) U2OS cells stably transduced with pCDH-DAXX.

(+++) Normal breast ATM (++) IDC ATM Lymph node metastasis negative positive P-value A B X200 C Vector ATM - WT.

WT KO A B Suppl. Fig 1 Supplemental Figure 1. The expression of CYLD in liver. (A) Immunohistochemical analysis of CYLD in liver tissue of adult wildtype.

Fig. 1 (A) (B) (C) * * * * Mock siRNA siRNA Day 3 Day DNA-PKcs Beta actin.

Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of.

Figure S1 Figure S1. (A) Screen of USPs for regulating c-Myc stability. Scores of c-Myc protein abundence was derived from two independent experiments.

Supplementary Figure 2: Representative Kaplan-Meier plots of overall survival considering alterations erbB signaling pathway genes and p53 in lung cancer.

Kami, et al. Supplementary Fig. S2A. Kami, et al. Supplementary Fig. S2B.

Supplemental Figure 1 Expression of UHRF1 detected by TaqMan qRT-PCR and many characteristics of patients were compared by Mann-Whiteney’s U-test. A. Expression.

Date of download: 6/22/2016 Copyright © 2016 American Medical Association. All rights reserved. From: Reduction of Hyaluronan-CD44–Mediated Growth, Migration,

Shimura Supplemental Figure 1

Main Figures and Tables

Src-Family Kinases Are Activated in Non-Small Cell Lung Cancer and Promote the Survival of Epidermal Growth Factor Receptor-Dependent Cell Lines Jie.

Supplementary Figure 1. Importance of first neighbours in breast cancer, hepatocellular carcinoma and non-small cell lung cancer in the SignaLink network.

Figure 3. CRTC1 directly regulates COX-2 and predicts a positive feedback loop deregulated following LKB1 loss. A) Protein immunoblot showing fold induction.

Aldehyde Dehydrogenase 1A1 Possesses Stem-Like Properties and Predicts Lung Cancer Patient Outcome Xiao Li, MD, Liyan Wan, MD, Jian Geng, MD, Chin-Lee.

From: Overexpression of the μ-Opioid Receptor in Human Non-Small Cell Lung Cancer Promotes Akt and mTOR Activation, Tumor Growth, and Metastasis Anesthes.

Supplemental Digital Content 4

Group IIa secretory phospholipase expression correlates with group IIa secretory phospholipase inhibition–mediated cell death in K-ras mutant lung cancer.

Supplemental Figures Supplemental Figure 1.

Fig. S1 PIPKI is highly expressed in cancer cell lines

(6h ) Supplemental Fig. 2 a. 32Dp210 b. 32Dp210 c. 32DP210

Volume 136, Issue 5, Pages (May 2009)

Volume 132, Issue 3, Pages (March 2007)

Fig. 1 Number of somatic mutations in representative human cancers, detected by genome-wide sequencing studies. Number of somatic mutations in representative.

APLCC ORAL ABSTRACT SESSIONS - MONDAY, NOVEMBER 26

Aldehyde Dehydrogenase 1A1 Possesses Stem-Like Properties and Predicts Lung Cancer Patient Outcome Xiao Li, MD, Liyan Wan, MD, Jian Geng, MD, Chin-Lee.

Molecular Therapy - Nucleic Acids

Volume 19, Issue 3, Pages (March 2017)

a b MCF-7 TR2 MCF-7 TR2 (Fold change) MTT Assay , (Fold change)

Supplementary Figure S2

FLAG β-actin p53 SET M.w. kDa D β-actin p53 G9a

The VEGF-C/Flt-4 axis promotes invasion and metastasis of cancer cells

Volume 23, Issue 1, Pages (July 2006)

Supplementary Figure 2. Effect of IL-32 and siRNA of IL-32 on melanoma, colon and prostate cancer cell growth and apoptosis as well as IL-32 expression.

AbH AbF p=0.01 p= p=0.004 p=0.001 Fold increase in 4

A B CDK2 CDK2 inhibition P Activated KRAS P CP110 CP110

P16Ink4a Suppression of Lung Adenocarcinoma by Bmi-1 in the Presence of p38 Activation Mi-Ok Lee, MSc, Hyeon-Jae Lee, MD, Mi-Ae Kim, MD, Eun-Kyung Kim,

Tumor Cell Content for Selection of Molecular Techniques for T790M EGFR Mutation Detection in Non-small Cell Lung Cancer Nathalie Prim, Elisabeth Quoix,

Characterizing the Killer Colorectal Carcinomas

-.&- ·Af& Q 0 "i'/

MUC1 Oncoprotein Stabilizes and Activates Estrogen Receptor α

A C D B Asynchronous nM Nocodazole 150 ► 100 ► 75 ►

Supplemental Figure 1 – Age Distribution in the CAC Consortium

Xiaolong Wei, Hai Xu, Donald Kufe Cancer Cell

MUC1 Oncoprotein Stabilizes and Activates Estrogen Receptor α

Supplementary Figure S4

Fold Change of hsa-miR-3687 (T/N)(log2)

Reh cells, 24 hours c-Myc Ac-p53 b-actin

Supplemental Figure 6 Effect of p. o

Aberrant Regulation of the MRP3 Gene in Non-small Cell Lung Carcinoma

Aglaya G. Iyevleva, MD, PhD Journal of Thoracic Oncology

Volume 37, Issue 2, Pages (January 2010)

The human GPR109A promoter is methylated and GPR109A expression is silenced in human colon carcinoma cells. The human GPR109A promoter is methylated and.

Supplementary Figure 1 A B C SW620 HT29 SW620

Jui-Hung Chang, Ph. D. , Heng-Kien Au, M. D. , Wei-Chin Lee, M. S

Fig. 2. Ex vivo inducible knockout of PDCD2 in ESCs results in loss of S phase entry and increased p53.(A) Growth curve of inducible knockout and WT ESCs.

Volume 14, Issue 5, Pages (June 2004)

Shipra Das, Olga Anczuków, Martin Akerman, Adrian R. Krainer

Caveolin-1 downregulated survivin expression in cells with enhanced or constitutive activity via the Wnt pathway. Caveolin-1 downregulated survivin expression.

pHSF1Ser230 is upregulated by TNF in colon cancer cells.

MAPJD expression in lung cancers.

Fig. 1 Number of somatic mutations in representative human cancers, detected by genome-wide sequencing studies. Number of somatic mutations in representative.

lncRNA HOXA11-AS is overexpressed in gastric cancer tissues.

Relative frequencies of FGFR aberrations in non–small cell lung carcinoma. Relative frequencies of FGFR aberrations in non–small cell lung carcinoma. A,

A B C Name Sequence TIMP3 promoter

NRP2 expression is associated with prostate cancer progression.

CREB1 binds at the proximal region of the TGFB2 promoter and induces its transcriptional activation. CREB1 binds at the proximal region of the TGFB2 promoter.

Presentation transcript:

Supplemental Figure S1 ResidueMass Delta Mass Sequence Mascot Ion Score R.DFGLLVFVR.K K.IPALDLLIK.L K.FYGELALK.K K.AALSALESFLK.Q K.DYVDLFR.H R.LPLISGFYK.L K.NNWEVSALSR.A K.NLSSNEAISLEEIR.I R.LSFAVPFR.E R.VTELALTASDR.Q R.TFPVLLR.L K.KFESQDTVALLEAILDGIVDPVDSTLR.D R.LYSLALHPNAFK.R R.LGASLAFNNIYR.E K.FVPLLPGNR.S R.TVGALQVLGTEAQSSLLK.A K.LATTILQHWK.K K.GQAVTLLPFFTSLTGGSLEELR.R K.GQAVTLLPFFTSLTGGSLEELRR.V R.EFFSTIVVDAIDVLK.S K.LNESTFDTQITK.K K.NLLIFENLIDLK.R K.NLLIFENLIDLKR.R K.LGNPIVPLNIR.L K.LVINTEEVFRPYAK.H R.YKEVYAAAAEVLGLILR.Y K.EVYAAAAEVLGLILR.Y R.DPESETDNDSQEIFK.L R.HGDLPDIQIK.H K.HSSLITPLQAVAQR.D K.QLFSSLFSGILK.E R.LLEEALLR.L K.LLLQGEADQSLLTFIDK.A K.LQSVQALTEIQEFISFISK.Q R.DQNILLGTTYR.I R.NELEIPGQYDGR.G R.LGLIEWLENTVTLK.D71 IgG Snail1-Flag DNA-PKcs Snail1-Flag IgGCon

DNA-PKcs Non-neoplasticCase 1Case 2Case 3Case 4Case 5 Snail1 DNA-PKcs Snail1 Human colon cancer Adenocarcinoma Squamouse cell carcinoma DNA-PKcs Snail1 Human lung cancer Supplemental Fig. S2

Snail1 GenBank: AF atgccgcgctctttcctcgtcaggaagccctccgaccccaatcggaagcctaactacagc M P R S F L V R K P S D P N R K P N Y S 61 gagctgcaggactctaatccagagtttaccttccagcagccctacgaccaggcccacctg E L Q D S N P E F T F Q Q P Y D Q A H L 121 ctggcagccatcccacctccggagatcctcaaccccaccgcctcgctgccaatgctcatc L A A I P P P E I L N P T A S L P M L I 181 tgggactctgtcctggcgccccaagcccagccaattgcctgggcctcccttcggctccag W D S V L A P Q A Q P I A W A S L R L Q 241 gagagtcccagggtggcagagctgacctccctgtcagatgaggacagtgggaaaggctcc E S P R V A E L T S L S D E D S G K G S(100) 301 cagccccccagcccaccctcaccggctccttcgtccttctcctctacttcagtctcttcc Q P P S P P S P A P S S F S S T S V S S 361 ttggaggccgaggcctatgctgccttcccaggcttgggccaagtgcccaagcagctggcc L E A E A Y A A F P G L G Q V P K Q L A 421 cagctctctgaggccaaggatctccaggctcgaaaggcctccaactgcaaatactgcaac Q L S E A K D L Q A R K A S N C K Y C N 481 aaggaatacctcagcctgggggcgctgaagatgcac K E Y L S L G A L K M H Supplemental Fig. S3

a b Normal controlCT26 cellsCT26-WTCT26-S100ACT26-S100D H&E Supplemental Fig. S4 ConWT S100A S100D Normal Con WT S100A S100D Normal Lung weight (%) CT26 * S100A S100D WT Con A549 E-cadherin promoter activity Snail1 * * Con WT S100A S100D Snail1 β -Actin Snail1 Migration activity (Fold increase) Con WT S100A S100D Snail * * A549

a c S104A/S107AWTS100A p-p53 (Ser15) p53 γ-H2AX Snail1 β-Actin Snail-Flag (IR, min)  -Actin Snail1 p-p53 (Ser15) p53  -H2AX NCI-H460 Snail1Con NCI-H460 SCSnail1siRNA : (IR, min) b NCI-H460 β-Actin Snail1 A549 WTS100A S104A / S107A pCR3.1 Snail1-Flag WT S100A S104A / S107A pCR3.1 Snail1-Flag pCR3.1 WT S100A S104A-107A H460A Snail1 DNA-PK kinase activity (Fold increase) Supplemental Fig. S5

b M059J Death(%) ConSnail1 Death(%) Si-Snail1 * * G2/M phase (%) M059J c DLD-1 Snail1 Snail1/shDNA-PKcs (day) * * * * * Supplemental Fig. S6 p-GSK3β (Tyr216) DNA-PKcs β-Actin p-DNA-PKcs (Ser2056) GSK3β (IR, min)3060 d a