Concept check
Look at the following pedigree of the family. Here the trait is expressed only in males. Do you think that the inheritance is Y linked? Explain with proper reason. What could be the alternate possible mode of inheritance? Predict the genotype of individuals A, B, C and D.
In both a & b males are affected. Are both follow same pattern of inheritance? Or different ? Give valid justification
Concept check
6 a) An enzyme X isolated from a eukaryotic cell has 192 amino acid residues and is coded by a gene with 1,440bp. Explain the relationship between the number of amino acid residues in the enzyme and the number of nucleotide pairs in its gene b) The b-globin gene has three exons of 140, 222 and 252 nucleotides and two introns of 130 and 850 nucleotides, using this information/data calculate the amino acids present in the polypeptide that the mature mRNA can encode?
7 A nucleotide analog X with the following chemical structure is present in abundance in a cell infected by HIV. This analog X blocks DNA chain elongation when it is incorporated into viral DNA synthesized by reverse transcriptase. Why does DNA synthesis stop? Concept check
8 Dr. Garrod’s finding on disease ‘Alkaptonuria’ was very significant due to the following reason. Choose most appropriate one. a.He showed that the patients are not victim of ‘black magic’ b.He showed that the ‘Alkaptonuria’ is not a major disease, patients can live with it c.He showed that genetic inheritance is connected to biochemical pathways in the body d.He proposed that first cousin marriage is wrong. No religion should encourage it. Concept check
9 The prokaryotic cells possess circular DNA as genetic material. Therefore, in the course of replication, they will not lose any genetic material as the cell divides. A eukaryotic cell having linear DNA as genetic material has a great probability of losing the information at ends of the DNA strand during replication. How has the eukaryotic cell evolved to overcome the loss of genetic matter in subsequent cycles of replication?
Concept check The discovery of reverse transcriptase has impact on life in and out of science in a myriad of ways. This enzyme has proved to be catalyzing the formation of (a)polypeptide from an RNA template (b)DNA from a polypeptide template (c)RNA from a polypeptide template (d)RNA from a DNA template (e)DNA from an RNA template
11 On the basis of the given sequence of DNA and the resulting protein produced in a eukaryotic cell, Determine the sequence of the mRNA (pre-processing and post- processing) (Note: shaded region is the promoter for the gene) DNA sequence 5’ CTGAGACTGCTCCGCCTCGCCATGACTATAACTGCTATCCTACAGCAGCATCGGATATCGCCAGTCGTCGGCCTAA 3’ 3’ GACTCTGACGAGGCGGAGCGGTACTGATATTGACGATAGGATGTCGTCGTAGCCTATAGCGGTCAGCAGCCGGATT 5 ’ Protein MethionineThreonineSerineTyrosineTyrosineArginineGlutamineSerineSerineAlanine-
12 On the basis of the given sequence of DNA and the resulting protein produced in a eukaryotic cell, Determine the sequence of the mRNA (pre-processing and post- processing) (Note: shaded region is the promoter for the gene)