Concept check. Look at the following pedigree of the family. Here the trait is expressed only in males. Do you think that the inheritance is Y linked?

Slides:

Advertisements

Similar presentations

Gene  Protein Chapter 17.

Advertisements

Lecture I Intro to Genetics & DNA Replication with a review in DNA, RNA, & Protein Synthesis.

© 2006 W.W. Norton & Company, Inc. DISCOVER BIOLOGY 3/e

DNA & genetic information DNA replication Protein synthesis Gene regulation & expression DNA structure DNA as a carrier Gene concept Definition Models.

Transcription & Translation

DNA Past Paper Questions. 1. Draw as simple diagram of the molecular structure of DNA. 5 marks.

Protein Synthesis.

RNA Ribonucleic Acid.

FROM GENE TO PROTEIN: TRANSCRIPTION & RNA PROCESSING Chapter 17.

GENE EXPRESSION.

Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used.

Chapter 10 – DNA, RNA, and Protein Synthesis

From Gene To Protein Chapter 17. The Connection Between Genes and Proteins Proteins - link between genotype (what DNA says) and phenotype (physical expression)

Chapter 17 Notes From Gene to Protein.

Gene Expression Chapter 13.

Gene Expression and Gene Regulation. The Link between Genes and Proteins At the beginning of the 20 th century, Garrod proposed: – Genetic disorders such.

RNA and Protein Synthesis

From Gene to Protein Chapter 17.

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

DNA Transcription and Translation: The Central Dogma

The initial RNA transcript is spliced into mature mRNA

The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits by dictating.

DNA Function: Information Transmission. ● DNA is called the “code of life.” What does it code for? *the information (“code”) to make proteins!

12-3 RNA and Protein Synthesis

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

Gene Regulations and Mutations

Chapter 17 From Gene to Protein.

Protein Synthesis - The “Stuff of Life”

 British physician from the 20 th century  Studied patients with alkaptonuria › A genetic disorder which causes black urine, containing alkapton  Garrod’s.

DNA TO PROTEIN genotype to phenotype Look deep into nature, and then you will understand everything better. Albert Einstein.

Chapter 17.1 & 17.2 Process from Gene to Protein.

DNA in the Cell Stored in Number of Chromosomes (24 in Human Genome) Tightly coiled threads of DNA and Associated Proteins: Chromatin 3 billion bp in Human.

While replication, one strand will form a continuous copy while the other form a series of short “Okazaki” fragments Genetic traits can be transferred.

The Central Dogma of Molecular Biology DNA  RNA  Protein  Trait.

Copyright © 2005 Brooks/Cole — Thomson Learning Biology, Seventh Edition Solomon Berg Martin Chapter 12 Gene Expression.

Chapter 10 Student DNA REPLICATION “It has not escaped our notice that the specific pairing we have postulated immediately suggested a possible.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

The Central Dogma of Life. replication. Protein Synthesis The information content of DNA is in the form of specific sequences of nucleotides along the.

 Genes are coded DNA instructions that will control the production of proteins  These messages have to change to RNA to be decoded.  RNA will give.

SC.912.L.16.3 DNA Replication. – During DNA replication, a double-stranded DNA molecule divides into two single strands. New nucleotides bond to each.

GROUP 2 DNA TO PROTEIN. 9.1 RICIN AND YOUR RIBOSOMES.

From Gene to Protein: Transcription & RNA Processing

RNA and Protein Synthesis

Chapter 10 – DNA, RNA, and Protein Synthesis

Protein Synthesis AP Ch 17.

DNA Replication.

Chapter 17 From Gene to Protein

Pharmacogenetics and Pharmacoepidemiology

Enzymes and their functions involved in DNA replication

DNA Test Review.

Gene Activity How Genes Work.

From Gene to Protein: Transcription & RNA Processing

Mutations are changes in the genetic material of a cell or virus

Analogy Video Central Dogma Analogy Video (Resources Page)

DNA Replication How to make a functional protein Transcription

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

General Animal Biology

Pharmacogenetics and Pharmacoepidemiology

TRANSCRIPTION Copyright © 2009 Pearson Education, Inc.

Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.

Protein Synthesis DNA to Proteins.

CHAPTER 10 Molecular Biology of the Gene

CHAPTER 17 FROM GENE TO PROTEIN.

CHAPTER 17 FROM GENE TO PROTEIN

Comparison Of DNA And RNA Synthesis in Prokaryotes and Eukaryotes

General Animal Biology

Presentation transcript:

Concept check

Look at the following pedigree of the family. Here the trait is expressed only in males. Do you think that the inheritance is Y linked? Explain with proper reason. What could be the alternate possible mode of inheritance? Predict the genotype of individuals A, B, C and D.

In both a & b males are affected. Are both follow same pattern of inheritance? Or different ? Give valid justification

Concept check

6 a) An enzyme X isolated from a eukaryotic cell has 192 amino acid residues and is coded by a gene with 1,440bp. Explain the relationship between the number of amino acid residues in the enzyme and the number of nucleotide pairs in its gene b) The b-globin gene has three exons of 140, 222 and 252 nucleotides and two introns of 130 and 850 nucleotides, using this information/data calculate the amino acids present in the polypeptide that the mature mRNA can encode?

7 A nucleotide analog X with the following chemical structure is present in abundance in a cell infected by HIV. This analog X blocks DNA chain elongation when it is incorporated into viral DNA synthesized by reverse transcriptase. Why does DNA synthesis stop? Concept check

8 Dr. Garrod’s finding on disease ‘Alkaptonuria’ was very significant due to the following reason. Choose most appropriate one. a.He showed that the patients are not victim of ‘black magic’ b.He showed that the ‘Alkaptonuria’ is not a major disease, patients can live with it c.He showed that genetic inheritance is connected to biochemical pathways in the body d.He proposed that first cousin marriage is wrong. No religion should encourage it. Concept check

9 The prokaryotic cells possess circular DNA as genetic material. Therefore, in the course of replication, they will not lose any genetic material as the cell divides. A eukaryotic cell having linear DNA as genetic material has a great probability of losing the information at ends of the DNA strand during replication. How has the eukaryotic cell evolved to overcome the loss of genetic matter in subsequent cycles of replication?

Concept check The discovery of reverse transcriptase has impact on life in and out of science in a myriad of ways. This enzyme has proved to be catalyzing the formation of (a)polypeptide from an RNA template (b)DNA from a polypeptide template (c)RNA from a polypeptide template (d)RNA from a DNA template (e)DNA from an RNA template

11 On the basis of the given sequence of DNA and the resulting protein produced in a eukaryotic cell, Determine the sequence of the mRNA (pre-processing and post- processing) (Note: shaded region is the promoter for the gene) DNA sequence 5’ CTGAGACTGCTCCGCCTCGCCATGACTATAACTGCTATCCTACAGCAGCATCGGATATCGCCAGTCGTCGGCCTAA 3’ 3’ GACTCTGACGAGGCGGAGCGGTACTGATATTGACGATAGGATGTCGTCGTAGCCTATAGCGGTCAGCAGCCGGATT 5 ’ Protein MethionineThreonineSerineTyrosineTyrosineArginineGlutamineSerineSerineAlanine-

12 On the basis of the given sequence of DNA and the resulting protein produced in a eukaryotic cell, Determine the sequence of the mRNA (pre-processing and post- processing) (Note: shaded region is the promoter for the gene)