Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.

Slides:

Advertisements

Similar presentations

Chapter 11 – Gene Expression

Advertisements

Chapter 23.  Agents that cause disease  Many microorganisms: bacteria, fungi, protozoa  Bacteria are prokaryotes, but only a few are pathogens; most.

Characterizing Uncultured Bacteria Michael Wagner Division of Microbial Ecology University of Vienna.

BIOINFORMATICS Ency Lee.

An analysis of “Bioinformatics analysis of SARS coronavirus genome polymorphism” by Pavlović-Lažetić, et. al Angela Brooks July 9, 2004 SoCalBSI Article.

Chlamydial inclusion membrane proteins: localization and characterization Nathanael Blake HHMI Summer Internship Mentor: Dr. Dan Rockey.

Biological Databases Notes adapted from lecture notes of Dr. Larry Hunter at the University of Colorado.

Influenza A Virus Pandemic Prediction and Simulation Through the Modeling of Reassortment Matthew Ingham Integrated Sciences Program University of British.

Chlamydiae Obligate intracellular pathogens. Obligate intracellular pathogens. Acute and/or persistent infections. Acute and/or persistent infections.

VIRUS PROPERTIES Infectious – must be transmissible horizontally Intracellular – require living cells RNA or DNA genome, not both* Most all have protein.

BLOSUM Information Resources Algorithms in Computational Biology Spring 2006 Created by Itai Sharon.

Sisältö Chapter 1: The History and Scope of Microbiology

Subsystem Approach to Genome Annotation National Microbial Pathogen Data Resource Claudia Reich NCSA, University of Illinois, Urbana.

Gyrase Mutation in Various Bacteria Leading to Fluoroquinolone (“Cipro”) Resistance By: Nancy Halliday Wesley Hanson Brenda Breeding.

Virus Replication.

Laboratory Training for Field Epidemiologists Typing May 2007 Sequencing and Phylogeny.

Metagenomic Analysis Using MEGAN4

Bergey’s “oddball” Gram negatives *Obligate intracellular parasites: Rickettsia Chlamydia *Bacteria lacking cell walls: Mycoplasma Spiroplasma.

Mammalian Chlamydiosis. Center for Food Security and Public Health, Iowa State University, 2013 Overview Organism History Epidemiology Transmission Disease.

DNA: The Information Molecule How did scientists use evidence to discover that the DNA molecule contains information?

Computational Biology, Part D Phylogenetic Trees Ramamoorthi Ravi/Robert F. Murphy Copyright  2000, All rights reserved.

HIV and Viruses Lucy Stacey Christella. Viruses  Obligate parasites of living cells  Can’t replicate without living host cell  Due to RNApol, ribosomes,

Bacterial Gene Expression and Regulation

GENUS: CHLAMYDIA Prof. Khalifa SifawGhenghesh

Essential knowledge 3.C.3:

STEPHANIE HINTZEN BIOL 471 SIV and HIV: Differences in Diversity and Divergence.

Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings Unit 4 Proteins Transcription (DNA to mRNA) Translation (mRNA to tRNA.

The Genetics of Viruses and Bacteria Chapter 18. Viruses A virus is a small infectious agent that can only reproduce inside the living cells of organisms.

Cyclins Presentation1 Cyclin family of the yeast S. cerevisiae: Biological vs. Bioinformatical Presented by: Tzvika HoltzmanYan Tsitrin.

Viruses. Biology of Viruses Structure of Viruses: Size -Less then 0.2 microns Parts of the Virus 1)Capsid: -Made of protein subunits 2) Inner core: made.

Plate 31 Introduction to Viruses. Smallpox Chickenpox Influenza (“the flu”) Herpes Polio Rabies Ebola Human Papillomavirus (HPV) Human Immunodeficiency.

Amino Acid Biosynthesis By Laura Voss. Biosynthesis vs. Metabolism Not the same as amino acid metabolism pathways. –Synthesis of most amino acids is only.

Microbiology Ch 17.1: Viruses 17.2: Monera. Virus: A non- cellular particle made up of genetic material and protein that can invade cells.

SC.912.L  In Eukaryotes: gene transfer only from parent to offspring during sexual reproduction (pre technology)  In Prokaryotes: genetic transfer.

1, StarOmics course,Lausanne, Monday November 19 th Training agenda Chemicals Reactions Enzymes Pathways.

What is a Virus? Particle of nucleic acid and protein which reproduce only by infecting living cells.

Virus: A biological particle composed of nucleic acid and protein Intracellular Parasites: organism that must “live” inside a host What is a Virus?

Viruses Mader-Chapter 21.

Copyright OpenHelix. No use or reproduction without express written consent1.

Viruses A “borrowed life”. Characteristics of Life All living things exhibit the following four characteristics: 1.Carry out metabolic activities to meet.

Virus: A biological particle composed of nucleic acid and protein Intracellular Parasites: organism that must “live” inside a host What is a Virus?

 Virus: A biological particle composed of nucleic acid and protein  Intracellular Parasites: organism that must “live” inside a host.

DON XAVIER N.D CHLAMYDIAE.

Immune System Slides pulled from powerpoint by Kim Foglia

Viruses. Classifying Viruses How to tell them apart.

Patterns of HIV-1 evolution in individuals with differing rates of CD4 T cell decline Markham RB, Wang WC, Weisstein AE, Wang Z, Munoz A, Templeton A,

Introducing Bioinformatics Using the Nitrogen Cycle Alyssa Bumbaugh Ron Peck Mark Radosevich.

Viruses Chapter

Unrooted phylogenetic tree showing the relationship between the human SLC2A gene family for all 14 members created using PHYLIP 3.6 softwareDistance between.

Viruses MARCUS MEHTA.

Chlamydia Dr. Hala Al-Daghistani.

Chlamydia trachomatis

Viruses Chapter

Bacteria and Viruses Viruses.

Bacteria and Viruses Viruses.

Virus Classification: The World of Viruses

Essential knowledge 3. C. 3: youtube. com/watch

Viruses Viruses – are segments of nucleic acids

Pick up a book (pg 338) and present trp operon with your team

Course of Protochlamydia type III secretion system activity during the developmental cycle. Course of Protochlamydia type III secretion system activity.

Biology WorkBench David Shiuan Department of Life Science,

Phylogenetic trees for fusion (F) and attachment (G) genes of selected HMPV isolates. Phylogenetic trees for fusion (F) and attachment (G) genes of selected.

Viruses Viruses – are segments of nucleic acids

Presentation transcript:

Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott

Background Intracellular parasites: viruses, bacteria (Chlamydias, Rickettsias), and protozoa (plasmodia) (CDC website) Tryptophan biosynthesis genes Tryptophan biosynthesis genes are found to varying degrees within the Chlamydiaceae family (“Kegg pathway” program) Immune response of humans to Chlamydia infection involves the release of interferon. This activates an enzyme that degrades tryptophan, thereby reducing Chlamydia reproduction inside the host cell (PubMed) Tryptophan is an essential amino acid in humans

Taxonomy Lineage (full): root; cellular organisms; Bacteria; Chlamydiae/Verrucomicrobia group; Chlamydiae; Chlamydiae (class); Chlamydiales Chlamydiaceae – Candidatus Clavochlamydia Candidatus Clavochlamydia salmonicola – Chlamydia Chlamydia muridarum Chlamydia suis Chlamydia trachomatis – Chlamydophila Chlamydophila abortus Chlamydophila caviae Chlamydophila felis Chlamydophila pecorum Chlamydophila pneumoniae Chlamydophila psittaci TaxBrowser in NCBI

Available Genomes Completed Candidatus Protochlamydia amoebophila UWE25 proteins; Completed Candidatus Protochlamydia amoebophila UWE25 proteins Completed Chlamydia muridarum Nigg proteins; Completed Chlamydia muridarum Nigg proteins Completed Chlamydia trachomatis A/HAR-13 proteins; Completed Chlamydia trachomatis A/HAR-13 proteins Completed Chlamydia trachomatis D/UW-3/CX proteins; Completed Chlamydia trachomatis D/UW-3/CX proteins Completed Chlamydophila abortus S26/3 proteins; Completed Chlamydophila abortus S26/3 proteins Completed Chlamydophila caviae GPIC proteins; Completed Chlamydophila caviae GPIC proteins Completed Chlamydophila felis Fe/C-56 proteins; Completed Chlamydophila felis Fe/C-56 proteins Completed Chlamydophila pneumoniae AR39 proteins; Completed Chlamydophila pneumoniae AR39 proteins Completed Chlamydophila pneumoniae CWL029 proteins; Completed Chlamydophila pneumoniae CWL029 proteins Completed Chlamydophila pneumoniae J138 proteins; Completed Chlamydophila pneumoniae J138 proteins Completed Chlamydophila pneumoniae TW-183 proteins NCBI – Genomic Biology

Enolase NCBI - Genome Blast Search and Tree Building

Dendrogram Enolase Unrooted tree (generated by Phylip's Drawtree) Workbench, ClustalW

Observation There are multiple serovars of Chlamydia tachomatis, distinguished by route of infection. Question Are there differences in their trp genes?

Comparison of Ocular (A) and Genital (D) TrpA Genes trpA_D CTTCTACAAAGGGACTTAGATTATCTACGCAGACTAAAAGACGCGGGAATAAATGGTGTG trpA_A CTTCTACAAAGGGACTTAGATTATCTACGCAGACTAAAAGACGCGGGAATAAATGGTGTG trpA_D TGCGTTATAGATCTTCCAGCACCTTTATCACACGGAGAAAAATCTCCATTTTTTGAAGAT trpA_A TGCGTTATAGATCTTCCAGCACCTTTATCACACGGAGAAAAATCTCC---TTTTGAAGAT trpA_D CTTTTAGCTGTAGGATTGGATCCTATTTTGCTTATTTCTGCAGGGACAACGCCGGAGCGG trpA_A CTTTTAGCTGTAGGATTGGATCCTATTTTGCTTATTTCTGCAGGGACAACGCCGGAGCGG trpA_D ATGTCTTTAATACAAGAATACGCAAGAGGCTTTCTGTATTATATCCCATGTCAAGCTACG trpA_A ATGTCTTTAATACAAGAACACGCAAGAGGCCTTCTGTATTATATCCCATA-CAAGCTACG

Ocular vs. Genital Tryptophan Synthase Polymorphisms in Chlamydia trachomatis tryptophan synthase genes differentiate between genital and ocular isolates J. Clin. Invest. Harlan D. Caldwell, et al. 111:1757 doi: /JCI17993

Question Has the Chlamydia L serovar that causes a systemic lymph node infection retained the tryptophan synthase (trpA) gene like the genital serovars, as opposed to acquiring nonsense mutations like the ocular serovars?