Figure S1 Figure S1. Phylogenetic tree of LexA binding sites in cyanobacteria, B.subtilis,  - proteobacteria and E.coli. Binding sites of cyanobacteria.

Slides:

Advertisements

Similar presentations

GS 540 week 5. What discussion topics would you like? Past topics: General programming tips C/C++ tips and standard library BLAST Frequentist vs. Bayesian.

Advertisements

PREDetector : Prokaryotic Regulatory Element Detector Samuel Hiard 1, Sébastien Rigali 2, Séverine Colson 2, Raphaël Marée 1 and Louis Wehenkel 1 1 Bioinformatics.

Combined analysis of ChIP- chip data and sequence data Harbison et al. CS 466 Saurabh Sinha.

Bioinformatics Motif Detection Revised 27/10/06. Overview Introduction Multiple Alignments Multiple alignment based on HMM Motif Finding –Motif representation.

Regulatory Motifs. Contents Biology of regulatory motifs Experimental discovery Computational discovery PSSM MEME.

Protein Structure Database Introduction Database of Comparative Protein Structure Models ModBase 生資所 g 詹濠先.

Nucleotide Level We define four statistics to describe how results are scored at the nucleotide level. If a base is part of an actual site and is predicted.

Domain Assignment to Transcription Factors 416 Proteins with at least one SCOP DBD assignment 416 Proteins with at least one SCOP DBD assignment PFAM assignments.

The Model To model the complex distribution of the data we used the Gaussian Mixture Model (GMM) with a countable infinite number of Gaussian components.

Promoter Analysis using Bioinformatics, Putting the Predictions to the Test Amy Creekmore Ansci 490M November 19, 2002.

Genome Evolution: Duplication (Paralogs) & Degradation (Pseudogenes)

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Genome of the week - Deinococcus radiodurans Highly resistant to DNA damage –Most radiation resistant organism known Multiple genetic elements –2 chromosomes,

T-COFFEE Multiple Alignments of Orthologous Sequences Horizontal Gene Transfer (Phylogenetic Trees) WebLogo.

Figure S1_Yao Qin et al. Figure S1 Occurrence and distribution of trihelix family in different plant species. Red branches in the cladogram indicate that.

발표자 석사 2 년 김태형 Vol. 11, Issue 3, , March 2001 Comparative DNA Sequence Analysis of Mouse and Human Protocadherin Gene Clusters 인간과 마우스의 PCDH 유전자.

* only 17% of SNPs implicated in freshwater adaptation map to coding sequences Many, many mapping studies find prevalent noncoding QTLs.

WEBLOGO PLUS Sagar Gaikwad and Mohit Agrawal. LTMT.-RGDIGNYLGLTVETISRLLGRFQKLGVL LTMT.-RGDIGNYLGLTVETISR LTMT.-RGDIGNYLGLTVETISRLLGRFQKLGVI.

Improving Gene Function Prediction Using Gene Neighborhoods Kwangmin Choi Bioinformatics Program School of Informatics Indiana University, Bloomington,

Using Mixed Length Training Sequences in Transcription Factor Binding Site Detection Tools Nathan Snyder Carnegie Mellon University BioGrid REU 2009 University.

COURSE OF BIOINFORMATICS Exam_31/01/2014 A.

DNA motifs potentially related to Regulating genes in Response to Nitrogen in Marine Cyanobacteria. Created By David Long VCU Biology Undergraduate June.

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Construction of Substitution Matrices

Evaluation of a phylogenetic footprinting method designed to discover regulatory elements in prokaryotes Rekin’s Janky EMBRACE RSMD Workshop November,

PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1.

Comparative genomics analysis of NtcA regulons in cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis Wen-Ting Huang.

Web Databases for Drosophila Introduction to FlyBase and Ensembl Database Wilson Leung6/06.

Computational Genomics and Proteomics Lecture 8 Motif Discovery C E N T R F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U E.

SRI International Bioinformatics 1 Genome Browser Markus Krummenacker Bioinformatics Research Group SRI, International Q

EJ Kochis.  Regulatory sequences found in intergenic regions of DNA  There are different types!  Repressor  Promoter  DNAa Sites.

SRI International Bioinformatics 1 Genome Browser Tomer Altman Bioinformatics Research Group SRI, International August 19th, 2009.

A collaborative tool for sequence annotation. Contact:

Figure S1. Alignment of sequences from the 5′-end to the Sm binding site of reported genomic sequences (9-15) for HSUR 1. MicroRNA binding sites are.

Cis-regulatory Modules and Module Discovery

Finding conserved transcription factor binding sites in promoter sequences NfkappaB motifs in promoters controling human NFkappaB gene family members Markella.

Local Multiple Sequence Alignment Sequence Motifs

Figure S1: Seventeen MHC alleles in lake whitefish including nucleotide and amino acid sequences. Putative peptide binding region (PBR) sites are indicated.

Finding genes in the genome

Pattern Discovery and Recognition for Understanding Genetic Regulation Timothy L. Bailey Institute for Molecular Bioscience University of Queensland.

C u e r n a v a c a C u e r n a v a c a RegulonDB: Curation, Literature Search, Notation and Evidences about Transcriptional Regulation and Transcription.

DNA-Protein Interactions & Complexes. Prokaryotic promoter Consensus sequence is not present in majority of prokaryotic promoters. Sequence motifs.

1 In Silico Identification of Promoters in Prokaryotic Genomes Manju Bansal Molecular Biophysics Unit Indian Institute of Science Bangalore

COURSE OF BIOINFORMATICS Exam_30/01/2014 A.

Template provided by: “posters4research.com” CONCLUSIONS AND FUTURE WORKS REFERENCE Cytochrome P450 (CYPs) are known to play a central role in insecticide.

` Comparison of Gene Ontology Term Annotations Between E.coli K12 Databases REDDYSAILAJA MARPURI WESTERN KENTUCKY UNIVERSITY.

Regulation of Gene Expression

Detection of genome regulation sequences

Learning Sequence Motif Models Using Expectation Maximization (EM)

Mark M Metzstein, H.Robert Horvitz Molecular Cell

Recitation 7 2/4/09 PSSMs+Gene finding

There are four levels of structure in proteins

Supplemental Figure S1. Alignment of drimenol synthase amino acid sequences from P. hydropiper and V. officinalis. Amino acid sequences were aligned with.

Multiple sequence alignment and analysis of SOFL proteins.

Protein Occupancy Landscape of a Bacterial Genome

Phosphopeptides identified harboring minimal binding motifs

Mapping Global Histone Acetylation Patterns to Gene Expression

Genome-wide Reconstruction of OxyR and SoxRS Transcriptional Regulatory Networks under Oxidative Stress in Escherichia coli K-12 MG1655 Sang Woo Seo,

Presented by, Jeremy Logue.

Properties of proteins and residues with frequent hotspot mutations

Genomes with Fe-S cluster assembly-related genes.

Volume 128, Issue 6, Pages (March 2007)

Characterization and Mutation Analysis of Human LEFTY A and LEFTY B, Homologues of Murine Genes Implicated in Left-Right Axis Development K. Kosaki,

Correction of Gene Annotation and Other Sequence Analysis of Arabidopsis Proteins Identified on the 2-D Gels in Figure 1.(A) Spot 71, identified as a 17.2-kD.

Presented by, Jeremy Logue.

Multiple sequence alignment of STAT6 and other STAT proteins produced by ClusterW and ESpript (espript.ibcp.fr/ESPript/ESPript/). Multiple sequence alignment.

The Bov-A2 element is conserved in the NOS2 gene of bovid species.

Phosphopeptides identified harboring minimal binding motifs

Phylogenetic analysis and domain structure of CALM proteins.

Gene regulatory regions of the insect/crustacean egr-B homologs.

Presentation transcript:

Figure S1 Figure S1. Phylogenetic tree of LexA binding sites in cyanobacteria, B.subtilis,  - proteobacteria and E.coli. Binding sites of cyanobacteria were predicted in this study, those of B.subtilis were from DBTBS [1], those of  -proteobacteria were taken from Erill et al [2], and those of E.coli were from RegulonDB [3]. Phylogenetic tree was constructed by the STAMP[4] web tool, sequence logos were generated by weblogo [5].

Synechococcus sp. JA-3-3Ab A-Prime Figure S3 Synechococcus_elongatus_PCC_6301 Thermosynechococcus_elongatus BP-1 Probability or LOR Score Figure S3. Results of genome-wide scanning for LexA-like binding sites in the five genomes that do not encode a LexA protein. Trichodesmium_erythraeum_IMS101 Score p(S Iu > s) p(S Cu > s) LOR N(S Iu > s) Number of predicted LexA boxes Synechococcus sp. JA-2-3B'a (2-13) B-Prime

Figure S4 Figure S4. Multiple sequence alignments of the full-length LexA in the 27 cyanobacterial genomes. The sequence from E.coli LexA is also included for comparison. The auto- cleavage sites are indicated by a red arrow, and the reactive residues are indicated by red dots.

T G1G1 g1g1 g2g2 t g1g1 g2g2 o 1 (g 1 ), o 1 (g 2 ) G2G2 o 2 (g 1 ) o 2 (g 2 ) g1g1 g2g2 Figure S5 in this example. putative binding site h For o 1 (g 1 ), o 2 (g 1 ) and o 2 (g 2 ), assume they have the same value of sequence similarity to h,i.e.,. Then we should select orthologs of g 1 in this case, i.e., i =1, and add its average score across genome G 1 and G 2 to S M (t).

References 1.Sierro N, Makita Y, de Hoon M, Nakai K: DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic Acids Res 2008, 6(Database issue):D Erill I, Jara M, Salvador N, Escribano M, Campoy S, Barbe J: Differences in LexA regulon structure among Proteobacteria through in vivo assisted comparative genomics. Nucleic Acids Res 2004, 32(22): Gama-Castro S, Jimenez-Jacinto V, Peralta-Gil M, Santos-Zavaleta A, Penaloza-Spinola MI, Contreras-Moreira B, Segura-Salazar J, Muniz- Rascado L, Martinez-Flores I, Salgado H et al: RegulonDB (version 6.0): gene regulation model of Escherichia coli K-12 beyond transcription, active (experimental) annotated promoters and Textpresso navigation. Nucleic Acids Res 2008, 36(Database issue):D Mahony S, Benos PV: STAMP: a web tool for exploring DNA-binding motif similarities. Nucleic Acids Res 2007, 35(Web Server issue):W Crooks GE, Hon G, Chandonia JM, Brenner SE: WebLogo: a sequence logo generator. Genome Res 2004, 14(6):