DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

Slides:

Advertisements

Similar presentations

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

Advertisements

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

14.4 Gene Mutations. What is a Mutation? A mutation is any change in the amount or structure of the DNA of an organism. KEY POINT: If this occurs in somatic.

Genes and mutations. What are genes? A molecular unit of heredity The name for stretches of DNA and RNA that code for a specific protein (which has a.

Human Genetic Mutations

8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.

 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,

Mutations. Change / alteration to the DNA of an organism They may be good, bad or have no effect A plant that can better tolerate the cold (GOOD) A change.

MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

Section 11.3 MUTATIONS Section 11.3 pgs

Mutations Chapter 12.4.

Genetic Changes 11.3.

Mutations 13.3.

Mutations Genetic Changes.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.

MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.

Mutations. What comes to mind???? Mutants.

Sometimes replication, transcription and translation don’t go as planned! Replication, Transcription, and Translation errors result in mutations. A mutation.

Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

L. COLEMAN GENE: the section of a DNA molecule that contains the recipe for one protein. NOTE: Each DNA molecule with it’s supporting structures.

Mutations Mutations are changes in DNA Mutations are changes in DNA These can occur in: These can occur in: Somatic cells – can cause tumours/cancersSomatic.

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.

Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.

MUTATIONS No this can’t happen with just mutations.

Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.

Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.

A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.

Mutations. We all make mistakes. Sometimes cells make mistakes, too -- -like when they copy their DNA.

Mutation Notes: Chapter 11.

Gene Expression and Regulation and Mutations

Section 11.3: Genetic Changes

12.4 Assessment Answers.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Copyright Pearson Prentice Hall

Mutations Add to Table of Contents – p. 14

MUTATIONS And their effect.

Sometimes replication, transcription and translation don’t go as planned! Replication, Transcription, and Translation errors result in mutations. A mutation.

Genetic Mutations.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

11.3 Section Objectives – page 296

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Mutations Ms MacCormack Fall 2018.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Mutations A mutation is any change in the DNA sequence.

Draw a conclusion from this graph for both the red and blue line

10th Grade Biology Mr. Walker

11.3 Section Objectives – page 296

Section 20.4 Mutations and Genetic Variation

Mutations: Changes in Genes

Presentation transcript:

DNA Mutations

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC What does it matter???

CACGTGGACTGAGGACTCCTC Codon for CTC = glutamate CACGTGGACTGAGGACACCTC Codon for CAC = valine What does it matter???

Mutation = any change in a DNA sequence -usually happens during DNA replication -in sex cells, it may affect individual’s offspring/children -in body cells, it may affect the individual

Mutations can: -be bad, leading to cancer, aging, birth defects, self-aborted embryos

-be good, making an organism survive better in its environment -Example: bacteria becoming antibiotic-resistant The ability to drink milk as an adult is a helpful mutation.

-have no effect -Example: -CAC = valine -CAT = valine

Types of Mutations 1.gene mutations – only affects one gene a. point mutation - a substitution of a single base pair - changes only one amino acid (if any!)

Types of Mutations b.frameshift mutation -a single base is added or deleted - changes every amino acid after mutation site -also called a nonsense mutation

Types of Mutations 2.Chromosomal mutation – may affect more than one gene Examples: nondisjunction, deletion, insertion, inversion, translocation

What can cause a mutation? ***A mutation can be inherited, caused by environmental agents, or happen spontaneously Mutagen – anything environmental that can cause a change in DNA

Mutagens  Radiation – UV, X-rays, nuclear

Mutagens  Chemicals – asbestos, formaldehyde, chemicals in tobacco products (many mutagens are also carcinogens – cancer causing)

Mutation Repair Note: Our DNA mutates all the time, but our cells have repair mechanisms. It is the overexposure to a mutagen that causes the worst problems, because the cell cannot repair all of it in time. Also, repair effectiveness reduces with age.

What’s Happening in Japan