Is My Gene Important for Seed Development in Plants?? Gene: AT3G53370 Jonathan Milgrom Spring 2004.

Slides:



Advertisements
Similar presentations
Diagnosis with PCR This is a preparation of DNA. We zoomed in a portion of a gene. We know that two primers, Forward and Reverse, will hybridize at specific.
Advertisements

T-DNA Mutagenesis T-DNA Mutagenesis. Transfer-DNA Mutagenesis: a chemical or physical treatment that creates changes in DNA sequence which can lead to.
Arabidopsis thealiana AT3G56230 AT4G18650 What are the functions of them? Are they important for seed development? Spring 2004 Mariko Onozawa.
Determining the roles of the BTB genes At2g04740, At4g08455, At1g04390, and At2g30600 in Arabidopsis thaliana growth and development. Brandon D. Blaisdell,
The Trihelix Transcription Factor Family Heather Hernandez.
Dicer-Like A RNA Helicase Gene Involved in Gene Silencing UCSF Max BachourJessica ChenChris McQuilkin.
Suppl Figure S1. mMDH genes in At and t-DNA mutant characterization. A) MDHs in Arabidopsis B) T-DNA insertions available At1g53240 mMDH1 At3g15020 mMDH2.
HC70AL Presentation: Gene-Knockout Analysis Arabidopsis Thaliana
Characterization of sugar-response Arabidopsis (Arabidopsis thaliana) mutants to engineer plants for higher ethanol, soydiesel and soy protein production.
Zinc Finger CONSTANS- Related and LOB-Domain Containing Genes Nancy Phang June 4, 2004.
What are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock- Out Mutations? Eric Newton Garen Polatoglu Rena Schweizer.
At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.
HC70AL Spring 2009 An Introduction to Bioinformatics By Brandon Le & Min Chen April 7, 2009.
What Are the Methods and Approaches Used Study Knock-Out Mutations? Elaine Chiu Nancy Phang June 4, 2009.
The MYB and BHLH Transcription Factor Families by Elaine Chiu.
Mutations in Arabidopsis Exocyst Gene AtSEC8 Jennie Hines Mentor: John Fowler.
Arabidopsis Experiments
A Hypothesis for the function of gene AT4G23180 in A. thaliana By Nicole Foxworth and Deborah Lee (Ether Fowl Ox)
Using mutants to clone genes Objectives 1. What is positional cloning? 2.What is insertional tagging? 3.How can one confirm that the gene cloned is the.
F-Box Containing Tubby Transcription Factor Family Daisy Robinton Goldberg Lab Spring 2006.
HC70AL Final Presentation Chris McQuilkin June 4 th, 2009.
Genes That Direct Transcription Co-activator Proteins : Do they disrupt/alter seed development? Gene 1: At5g09250 Gene 2: At5g09240 Combiz Richard Abdolrahimi.
Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem.
The SET-Domain Containing Protein and MYB-related Families: Genes AT2G05900 & AT1G17460 Kristin Gill HC70AL Spring 2008.
Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.
Figure S1. Alignment of identified AtMYB93/92/53 homologues in land plants, used to infer the phylogeny in Figure 1B. Supporting information Figs S1-S7.
Gene expression (signal intensity) Control Osmotic Salt Drought Root Control Gene expression (signal intensity) Treatment.
Fig. S1. Amino acid sequence alignment of MYBS3 proteins. MYBS3 protein sequences of Arabidopsis thaliana (MYBH; NP_199550); (At3g16350; NP_188256), Glycine.
AtPAT10 TIP1 Akr1p1 Akr2p Erf2p Swf1p Pfa5 Pfa3 GODZ HIP14 Pfa4 AtPAT10 TIP1 Akr1p1 Akr2p Erf2p Swf1p Pfa5 Pfa3 GODZ HIP14 Pfa4 AtPAT10 TIP1 Akr1p1 Akr2p.
The HAT2 Homeodomain-Like Transcription Factor Family: Genes AT5G47370 and AT4G17460 Bekah Charney HC70AL Spring 2006.
Supplementary figure 1 Colorimetric analysis of inorganic P by molybdenium staining of hydrochloric extracts of rice grains in rice grains (non-embryo.
Ctcgaacttgtttttggttcatctctcaaaaccaaaatcactaaagaggagaagattgctaaagtttgataaaacattccaaaatca ATGGCTGATAGGATCAAAGGTCCATGGAGTCCTGAAGAAGACGAGCAGCTTCGTAGGCTTGTTGTTAAATACGGTCCAAGAAACTGG.
THE FUNCTION OF AT5G04410 (NAC2) AND AT3G10500 (NAC2-like) NAC Family
Daisy Robinton Matt Emmer Jason Chai
The Role of Genes AT5G48150 and AT2G04890 in Arabidopsis thaliana Seed Development Jennifer Huynh June 8, 2006 Honors Collegium 70AL Professor Bob Goldberg.
The C3HC4-Type RING Zinc Finger and MYB Transcription Factor Families Matthew Taube June 5, 2008 HC70AL.
Homeobox leucine zipper protein 9 (HAT9) -AT2G Homeodomain(s) -Leucine Zipper Motif -DNA Binding -Dimerization ?? ~ Helix-turn-helix 5’3’ FWRV.
Genetics & Genotyping By Kristin Gill & Daisy Robinton HC70AL Spring 2009.
Determining Functionality of Arabidopsis Thaliana Genes in Embryo Development Ria Yagnik.
Searching for Genes Important in Seed Development At1g19000 At1g74840 BY: Mike Douglas.
WT#3#5#7#9#11#14#15#20#25#30 35S::JAZ13 Root length ratio * * * * * * * * * * Figure S2. Overexpression of native (untagged)
Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.
ATG AREB1 (At1g45249) AREB2 (At3g19290) ABF3 (At4g34000) ABF1 (At1g49720) No treatmentABA, 6h Chr. 1 areb1 (SALK_002984) // Chr. 3 Chr. 4 abf1-2 (SALK_132819)
NAC Family Genes AT1G01720 AT1G77450
Searching for the Genes that Control Seed Development
a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c
Are At1g08810 and At3g50060 Important to Arabidopsis Seed Development?
SUMOylated SIZ1 may play an important role
Emily Eder HC70AL - Spring 2005
Tandem Inserts, Phenotypic Segregation, Hypocotyl Length, and More…
Is AT2G23290 Important in Seed Development?
Welcome to the world of two Arabidopsis genes:
The Alfin-like PHD Zinc Finger Transcription Factor Family
Does Gene AT5G19490 Play a vital role in seed development?
HC70AL Final Presentation
Put Your Dukes Up AT5G03220! Studying Embryo Lethality of
HC70AL Oral Presentation
What is AT5G03500? --Background and Structure--
At2G37120: A Gene Exploration
Searching for a Knockout Line for a Gene of Interest in Arabidopsis
Arabidopsis Transcription Factor Genes NF-YA1, 5, 6, and 9 Play Redundant Roles in Male Gametogenesis, Embryogenesis, and Seed Development  Jinye Mu,
HC70AL Research Presentation
Heat Shock Factor Protein Family of Transcription Factors
Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2
Molecular cloning of pms916 salt hypersensitive T-DNA mutant.
Arabidopsis Thaliana Gene AT5G58610
Arabidopsis Gene At1G49560 Maria Garcia June 5, 2008.
Searching for a Knockout Line for a Gene of Interest in Arabidopsis
7 WT 6 irx1-6 ixr fold increased expression 3 2 n- 1 AT1G18710
Mitochondrial Sulfide Detoxification Requires a Functional Isoform O- Acetylserine(thiol)lyase C in Arabidopsis thaliana  Consolación Álvarez, Irene García,
Presentation transcript:

Is My Gene Important for Seed Development in Plants?? Gene: AT3G53370 Jonathan Milgrom Spring 2004

What Does My Gene Do? Transcription Factor* Repressor of Spinach gene rps1 Active in roots Highly conserved in plant kingdom Transcription factor *Dao-Xiu Zhou, Cordelia Bisanz Seyer

Is This Function Integral to Seed Development ? Knockout the gene and find out! Engineer agrobacteria to insert tDNA Grow mutant seeds Genotype Can an Arabidopsis plant develop without a functioning form of my gene? Agrobacteria naturally performs this task tDNA AT3G53370

Madison & Salk Provide the Knockouts 5’3’ SP #1 SP #4 Madison Salk AT3G53370 Exon

Knockout Analysis Madison project began with… Superpool Salk project began with… Mutant seeds Superpool tDNA line/ Genotype Mutant Seed Plant Sp #4 PCR products amplified with RV (gene specific) and tdna primers 4/15/04 (small length suggests insertion)

Madison Results Identified Madison DNA Pool SP #4 DNA pool #6 Madison PCR products amplified with RV (gene specific) & tdna primers 5/18/04 3 SP#4SP#4 AT3G ’ 5’ tDNA RV

SALK Results Homozygous tDNA exist Knockout is not embryo lethal genotype ** Wild Type ** Heterozygous *** Homozygous tDNA Plant # Wild type PCR products of various SALK lines amplified with FW & RV (gene specific) primers 6/4/04 PCR products of various SALK lines amplified with RV (gene specific) and tDNA primers 6/1/ WtWt C WtWt C Tubulin 7 Plants Genotyped…

Does My Gene Play Some Role in Seed Development? Scarlet Runner Bean equivalent Gene activity/mRNA accumulation patterns Lec1 mutant Arabidopsis 14 day old embryo RT-PCR of 6 organs

Next…? Study rsp1 spinach gene equivalent in Arabidopsis Study lec1 gene Identify Madison tDNA line and Genotype