Mouse regulatory DNA landscapes reveal global principles of cis-regulatory evolution by Jeff Vierstra, Eric Rynes, Richard Sandstrom, Miaohua Zhang, Theresa.

Slides:

Advertisements

Similar presentations

Finding regulatory modules from local alignment - Department of Computer Science & Helsinki Institute of Information Technology HIIT University of Helsinki.

Advertisements

A turbo intro to (the bioinformatics of) microRNAs 11/ Peter Hagedorn.

Microarrays and Cancer Segal et al. CS 466 Saurabh Sinha.

Promoter Analysis using Bioinformatics, Putting the Predictions to the Test Amy Creekmore Ansci 490M November 19, 2002.

Comparative Genomics II: Functional comparisons Caterino and Hayes, 2007.

An Introduction to ENCODE Mark Reimers, VIPBG (borrowing heavily from John Stamatoyannopoulos and the ENCODE papers)

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Log 2 (expression) H3K4me2 score A SLAMF6 log 2 (expression) Supplementary Fig. 1. H3K4me2 profiles vary significantly between loci of genes expressed.

The 5300-year-old Helicobacter pylori genome of the Iceman by Frank Maixner, Ben Krause-Kyora, Dmitrij Turaev, Alexander Herbig, Michael R. Hoopmann, Janice.

DNAse Hyper-Sensitivity BNFO 602 Biological Sequence Analysis, Spring 2014 Mark Reimers, Ph.D.

A Draft Sequence of the Neandertal Genome by Richard E. Green, Johannes Krause, Adrian W. Briggs, Tomislav Maricic, Udo Stenzel, Martin Kircher, Nick Patterson,

Food Security: The Challenge of Feeding 9 Billion People by H. Charles J. Godfray, John R. Beddington, Ian R. Crute, Lawrence Haddad, David Lawrence, James.

Comment on “Chromosomal Instability and Tumors Promoted by DNA Hypomethylation” and “Induction of Tumors in Mice by Genomic Hypomethylation” by Allen S.

Role of Apoptosis in Pseudomonas aeruginosa Pneumonia by Richard S. Hotchkiss, W. Michael Dunne, Paul E. Swanson, Christopher G. Davis, Kevin W. Tinsley,

Genomics 2015/16 Silvia del Burgo. + Same genome for all cells that arise from single fertilized egg, Identity?  Epigenomic signatures + Epigenomics:

Convergent transcriptional specializations in the brains of humans and song-learning birds by Andreas R. Pfenning, Erina Hara, Osceola Whitney, Miriam.

Comment on “A Complete Skull from Dmanisi, Georgia, and the Evolutionary Biology of Early Homo” by Jeffrey H. Schwartz, Ian Tattersall, and Zhang Chi Science.

Change in Pufs and their RNA InteractionsAnalogous change in transcription factors and their gene regulation Puf binding specificity tends to be conserved.

Open Source Physics by Wolfgang Christian, Francisco Esquembre, and Lyle Barbato Science Volume 334(6059): November 25, 2011 Published by AAAS.

A global quantification of “normal” sleep schedules using smartphone data by Olivia J. Walch, Amy Cochran, and Daniel B. Forger Science Volume 2(5):e

Volume 43, Issue 1, Pages (July 2011)

DNase‐HS sites are main independent determinants of DNA replication timing Simulations based on genome sequence features (GC content, CpG islands), or.

An international effort to cure a global health problem: A report on the 19th Hemoglobin Switching Conference Gerd A. Blobel, David Bodine, Marjorie.

Dynamic epigenetic enhancer signatures reveal key transcription factors associated with monocytic differentiation states by Thu-Hang Pham, Christopher.

Genetic Analysis of Development in Vertebrates

by Yue Shen, Wang Zhang, Shu-Lei Chou, and Shi-Xue Dou

Long-read sequence assembly of the gorilla genome

Guiding DNA Methylation

Ultraconserved Elements in the Human Genome

by Angela L. Rasmussen, Atsushi Okumura, Martin T

Alignment of distal NOS2 promoters from cattle, human, and sheep, and the Bov-A2 element. Alignment of distal NOS2 promoters from cattle, human, and sheep,

A functional proteomics platform to reveal the sequence determinants of lysine methyltransferase substrate selectivity by Evan M. Cornett, Bradley M. Dickson,

ChromEMT reveals the in situ chromatin ultrastructure, 3D packing, and organization of DNA. ChromEMT reveals the in situ chromatin ultrastructure, 3D packing,

Integration of omic networks in a developmental atlas of maize

The Ties That Bind: Mapping the Dynamic Enhancer-Promoter Interactome

Models of education in medicine, public health, and engineering

A Lexicon for Homeodomain-DNA Recognition

Student-Directed Discovery of the Plant Microbiome and Its Products

Fig. 4. MATE1 transcription in RCC.

The Antisense Transcriptomes of Human Cells

Volume 24, Issue 7, Pages (August 2018)

Volume 5, Issue 3, Pages e5 (September 2017)

Fig. 2. Best model fits. Best model fits. Illustration of the best model fits for the (A) basic, (B) continuous, and (C) cluster models. See Table 1 and.

Volume 8, Issue 6, Pages (September 2014)

Comment on “High-resolution global maps of 21st-century forest cover change” by Robert Tropek, Ondřej Sedláček, Jan Beck, Petr Keil, Zuzana Musilová, Irena.

Div-Seq: Single-nucleus RNA-Seq reveals dynamics of rare adult newborn neurons by Naomi Habib, Yinqing Li, Matthias Heidenreich, Lukasz Swiech, Inbal Avraham-Davidi,

Role of DNA Methylation in Modulating Transcription Factor Occupancy

Dynamic profiling of the protein life cycle in response to pathogens

Volume 11, Issue 2, Pages (April 2015)

by Matthew F. Chisholm, Yuhuang Wang, Andrew R

Volume 122, Issue 6, Pages (September 2005)

Congratulations! Now Get to Work

Complex evolutionary trajectories of sex chromosomes across bird taxa

Fig. 2 Activation of freshly isolated CD4+ T cells from HIV-infected patients on ART results in successive increases in elongated, polyadenylated, and.

Divergent Transcription from Active Promoters

Structures of the RNA polymerase-σ54 reveal new and conserved regulatory strategies by Yun Yang, Vidya C. Darbari, Nan Zhang, Duo Lu, Robert Glyde, Yi-Ping.

Suboptimization of developmental enhancers

Expression profiles of 5,493 transcripts grouped by k-means clustering

TFs and predicted regulatory networks for the tissue- and lineage-dependent clusters 2, 3, and 9. TFs and predicted regulatory networks for the tissue-

Analysis of the nonsynonymous to synonymous substitutions dN/dS (ω) for the 5,493 1:1 ortholog transcripts. Analysis of the nonsynonymous to synonymous.

Cross-species analysis of maternal gene transcripts.

Fig. 5 Conservation of m6A in mammals.

Fig. 2 Dynamics of H3K4me3 in human early development.

Systematic viral epitope scanning (VirScan).

Volume 11, Issue 7, Pages (May 2015)

by Matthew H. Spitzer, Pier Federico Gherardini, Gabriela K

Mesenchymal Stem Cell-Derived Vesicles Reverse Hematopoietic Radiation Damage by Sicheng Wen, Laura R Goldberg, Mark S Dooner, John L Reagan, and Peter.

Comparison of the frequency of nucleotide variation in the mtDNA D-loop region between stomach and other tumor cell lines. Comparison of the frequency.

Evolution-informed forecasting of seasonal influenza A (H3N2)‏

Median unweighted UniFrac distances between three dolphin habitats: Shedd, MMP, and Sarasota. Median unweighted UniFrac distances between three dolphin.

Presentation transcript:

Mouse regulatory DNA landscapes reveal global principles of cis-regulatory evolution by Jeff Vierstra, Eric Rynes, Richard Sandstrom, Miaohua Zhang, Theresa Canfield, R. Scott Hansen, Sandra Stehling-Sun, Peter J. Sabo, Rachel Byron, Richard Humbert, Robert E. Thurman, Audra K. Johnson, Shinny Vong, Kristen Lee, Daniel Bates, Fidencio Neri, Morgan Diegel, Erika Giste, Eric Haugen, Douglas Dunn, Matthew S. Wilken, Steven Josefowicz, Robert Samstein, Kai-Hsin Chang, Evan E. Eichler, Marella De Bruijn, Thomas A. Reh, Arthur Skoultchi, Alexander Rudensky, Stuart H. Orkin, Thalia Papayannopoulou, Piper M. Treuting, Licia Selleri, Rajinder Kaul, Mark Groudine, M. A. Bender, and John A. Stamatoyannopoulos Science Volume (): November 19, 2014 Published by AAAS

Fig. 1 Conservation of mouse regulatory DNA in humans.(A) The accessible landscape of the mouse was derived from 45 tissues and cell types. Jeff Vierstra et al. Science 2014;science Published by AAAS

Fig. 2 Cell and tissue lineage encoding within shared regulatory elements.(A) k-means clustering of DHSs by accessibility at each of the 475,701 mouse DHSs shared with human. Jeff Vierstra et al. Science 2014;science Published by AAAS

Fig. 3 Conservation and repurposing of regulatory DNA activity.(A) Pairwise comparison (median Jaccard distance) of shared DHS landscape usage between all mouse (rows) and human (columns) tissues largely mirrors their conserved morphological and embryological origins. Jeff Vierstra et al. Science 2014;science Published by AAAS

Fig. 4 Evolutionary dynamics of transcription factor recognition sequences within regulatory DNA.(A) Conservation of TF recognition sequences within shared DHSs. (B) Conserved TF recognition sequences (both positional and operational conservation) are enriched within DHSs that have conserved tissue activity patterns. Jeff Vierstra et al. Science 2014;science Published by AAAS

Fig. 5 Conservation of global cis-regulatory content predominates that of individual regulatory elements.(A) Density of individual TF recognition sequences in human (x axis) and mouse (y axis) regulatory T cells. Jeff Vierstra et al. Science 2014;science Published by AAAS