From DNA to RNA Biology

Do you remember what proteins are made of ? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make, and some we can’t There are infinite combinations of amino acids Can be hundreds or thousands monomers long. These long chains are called polypeptide chains

Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: DNA is only found in the nucleus Proteins are only made outside the nucleus – in the cytoplasm. Houston, we have a problem.

Protein Synthesis How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA – RNA – is used to carry these messages.

Before we talk about RNA, let’s review DNA (it’s been a while)

DNA - structure DNA – deoxyribonucleic acid Shape – double helix formed from 2 strands running in opposite directions Composed of repeating nucleotides Each nucleotide consists of one sugar – deoxyribose one phosphate – PO 4 3- one nitrogen base – adenine, guanine, cytosine, or thymine

Nitrogen Bases Purines – composed of two rings adenine(A) guanine(G) Pyrimidines – composed of one ring thymine(T) cytosine(C) One purine and one pyrimidine hydrogen bond to join the two strands adenine hydrogen bonds(2) with thymine cytosine hydrogen bonds(3) with guanine

N H O CH 3 N N O N N N NH Sugar Adenine (A) Thymine (T) N N N N Sugar O H N H N H N O H H N Guanine (G) Cytosine (C) Figure 16.8 H

The Double Helix

Nucleotides Phosphate is on the “outside” Sugar is in the “middle” Base is in the “inside” phosphate group sugar (deoxyribose) ADENINE (A) base with a double-ring structure THYMINE (T) base with a single-ring structure CYTOSINE (C) base with a single-ring structure GUANINE (G) base with a double-ring structure

DNA Structure deoxyribose phosphate thymineadenine cytosine guanine 5’ 3’ 5’

DNA Replication The process of copying the DNA. Each strand acts as a template for building a new strand in replication Semiconservative – each new DNA molecule consists of one new strand and one old strand.

DNA Replication Bases pairs of original DNA molecule An enzyme called helicase cause the hydrogen bonds to break & DNA begins to “unzip” Free DNA nucleotides are paired with bases from the original strand. DNA Polymerase bonds the free nucleotides to the original strands The result is 2 identical molecules of DNA – each with one new strand and one old strand 5’5’ 5’5’ 3’ 5’ 3’ 5’ 3’

Ribonucleic Acids (RNA) RNA is almost exactly like DNA, except: Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) Contains uracil instead of thymine. RNA is single-stranded, not double- stranded (usually…)

Ribonucleic Acids (RNA)

RNA The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). RNA Consists of only one strand of nucleotides. –Nucleotides – one sugar(ribose), one phosphate, and one nitrogen base Nitrogen bases = adenine, uracil, cytosine, and guanine.

3 Types of RNA 1.Messenger RNA (mRNA) – carries a message from the DNA to the cytoplasm 2.Transport RNA (tRNA) – transports amino acids to the mRNA to make a protein 3.Ribosomal RNA (rRNA) – make up ribosomes, which make protein.

Protein Synthesis OVERVIEW Occurs in TWO steps:  Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA  Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA.

The Central Dogma: This order of events is called the central dogma of molecular biology:

Step One: Transcription  DNA unzips: enzymes split apart base pairs and unwind the DNA double helix.  Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase. What will be different??  New backbone formed: The sugar- phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA U A U G G C A U A U U A

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA UAUGGCAUAUUAUAUGGCAUAUUA

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATCGCATATTATATCGCATATTA UAUGGCAUAUUAUAUGGCAUAUUA

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA UAUGGCAUAUUAUAUGGCAUAUUA

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA UAUGGCAUAUUAUAUGGCAUAUUA

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA UAACGCAUAUUAUAACGCAUAUUA

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA UAACGCAUAUUAUAACGCAUAUUA

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA UAACGCAUAUUAUAACGCAUAUUA

Protein Synthesis Transcription Enzyme unzips DNA Free RNA nucleotides bond with one side of DNA strand RNA polymerase bonds the RNA nucleotides together. mRNA leaves the nucleus for the cytoplasm DNA strands are rebonded ATACCGTATAATATACCGTATAAT TATGGCATATTATATGGCATATTA

Step One: Transcription Watch this simplified animation: mat/molgenetics/transcription.swf Watch the more complex animation! class.unl.edu/biochem/gp2/m_biology/anima tion/gene/gene_a2.html

Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA

Protein Synthesis Translation Involves all three types of RNA Ribosome(with rRNA) attaches to mRNA Ribosome locates the start codon “AUG” on the mRNA. On each tRNA is a “anticodon” that matches each codon tRNA “carries” or “transfers” the amino acids to the ribosome as the ribosome “reads” the 3-letter codon in the mRNA. As each tRNA lines up according to the sequence of codons, peptide bonds form between the amino acids.

Step Two: Translation  So how exactly do you go about determining what protein your cells are going to make?  FIRST, Divide the mRNA sequence into codons. As you just saw and heard, codons are three-base sections of mRNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Step Two: Translation  Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ?

The Genetic Code

Step Two: Translation  Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met ?

The Genetic Code

Step Two: Translation  Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon:

The Genetic Code

Step Two: Translation  Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: STOP

Translation U A U G G C A U A U U A G U A C met C G U ala A U A isol

Translation U A U G G C A U A U U A G U A C met C G U ala A U A isol

Translation U A U G G C A U A U U A G U A C met C G U ala A U A isol

Translation U A U G G C A U A U U A G U A C met C G U ala A U A isol

Translation U A U G G C A U A U U A G U A C met C G U ala A U A isol

Translation U A U G G C A U A U U A G U A C met C G U ala A U A isol

Translation U A U G G C A U A U U A G U A C met C G U ala A U A isol

Translation U A U G G C A U A U U A G met C G U ala A U A isol

Translation U A U G G C A U A U U A G met C G U ala A U A isol

Translation U A U G G C A U A U U A G met ala A U A isol A U C stop

Translation U A U G G C A U A U U A G met ala A U A isol A U C stop

Translation U A U G G C A U A U U A G met ala A U A isol A U C stop

Translation U A U G G C A U A U U A G met ala A U A isol A U C stop

Translation U A U G G C A U A U U A G met ala A U A isol A U C stop

Translation U A U G G C A U A U U A G met ala A U A isol A U C stop

Translation U A U G G C A U A U U A G met ala isol A U C stop Protein Assembled

Step Two: Translation Watch this simplified animation: mat/molgenetics/translation.swf Watch the more complex animation! class.unl.edu/biochem/gp2/m_biology/anima tion/gene/gene_a3.html

Protein Synthesis Worksheet Copy the 7 steps from the top of the worksheet into your notes.

Protein Synthesis Worksheet C C G C A U G C A C A C C G G A C C A U A G C G C U A U C C G C A U G C A C A C C G A C C A U A G C G C U A U C C G C A U G C A C A C C G A G A C C A U A G C G C U A U

Protein Synthesis Worksheet C C G C A U G C A C A C C G G A C C A U A G C G C U A U C C G C A U G C A C A C C G A C C A U A G C G C U A U C C G C A U G C A C A C C G A G A C C A U A G C G C U A U

Protein Synthesis Worksheet C C G C A U G C A C A C C G G A C C A U A G C G C U A U C C G C A U G C A C A C C G A C C A U A G C G C U A U C C G C A U G C A C A C C G A G A C C A U A G C G C U A U StartHisThreGlyProSTOP StartHisThreAspHisSer StartHisThreAspThrIso Ala

RECAP:  DNA is transcribed into mRNA in the nucleus.  The mRNA leaves the nucleus and enters the cytoplasm.  The protein is translated from the mRNA sequence using tRNA and amino acids.

Works Cited Mr. Armfield Sci. Dept. Deerfield High School, Deerfield IL