PAP Biology Warm up Discuss at your table what protein synthesis is…….using the terms: transcription, translation, mRNA, rRNA, tRNA, codon, anticodon and.

Slides:

Advertisements

Similar presentations

3 Types of RNA.

Advertisements

DNA Transcription & Protein Translation

End Show Slide 1 of 39 Copyright Pearson Prentice Hall Biology Protein Synthesis: I will understand the general pathway of transcription and translation.

10-2: RNA and 10-3: Protein Synthesis

What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.

Translation (Protein Synthesis) RNA  protein. Making a protein Many RNAs needed –mRNA, tRNA, rRNA.

RNA Ribonucleic Acid.

Protein Synthesis: The Central Dogma of Biology Chapter 8 in your textbook.

Proteins are made by decoding the Information in DNA Proteins are not built directly from DNA.

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

Transcription and Translation

RNA & Protein Synthesis Chapter 13. DNA A book of instructions that tells each individual what proteins to make for their needs. The path from genes to.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

RNA AND PROTEIN SYNTHESIS RNA vs DNA RNADNA 1. 5 – Carbon sugar (ribose) 5 – Carbon sugar (deoxyribose) 2. Phosphate group Phosphate group 3. Nitrogenous.

VII RNA and Protein Synthesis

CHAPTER 12: GENETICS.

RNA Ribonucleic Acid. Structure of RNA  Single stranded  Ribose Sugar  5 carbon sugar  Phosphate group  Adenine, Uracil, Cytosine, Guanine.

DNA Notes DAY 2 Replication, overview of transcription, overview of translation WARM UP What is the base pairing rule? Who created it?

RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.

DNA, RNA and Protein Synthesis. In eukaryotes, genetic information is stored in which organelle? nucleus.

Chapter 12 Making Proteins. Differences between RNA and DNA DNA = double strand; RNA = single strand RNA contains Ribose instead of deoxyribose. RNA uses.

SC.912.L.16.5 Protein Synthesis: Transcription and Translation.

CHAPTER 12 STUDY GUIDE MATER LAKES ACADEMY MR. R. VAZQUEZ BIOLOGY

RNA Structure Like DNA, RNA is a nucleic acid. RNA is a nucleic acid made up of repeating nucleotides.

RNA and Protein Synthesis

3 types:  mRNA – used in transcription  tRNA – used in translation  rRNA – makes up ribosomes Composed of nucleotides  5 carbon sugar = ribose  phosphate.

12-3 RNA and Protein Synthesis

DNA to Protein Transcription & Translation.  What are these nucleotides telling us?  Sequence of nucleotides in DNA contains information to produce.

RNA. What is RNA?  RNA stands for Ribonucleic acid  Made up of ribose  Nitrogenous bases  And a phosphate group  The code used for making proteins.

DNA Transcription & Protein Translation. Today’s Objectives Introduce Protein Synthesis Compare types of nucleic acid.

TEST ON THURSDAY, MARCH 7 DNA REVIEW ANSWERS. QUESTION #1 What are the 3 parts of a DNA nucleotide? Sugar – deoxyribose Phosphate group Nitrogen base.

Protein Synthesis.

DNA Transcription & Protein Translation. DNA Transcription DNA must be copied to messenger RNA (mRNA) in the nucleus mRNA travels from nucleus to the.

Protein Synthesis: Transcription & Translation.

Protein Synthesis. RNA (RIBONUCLEIC ACID)  Nucleic acid involved in the synthesis of proteins  Subunits are nucleotides  Nucleotides are composed of.

Making of Proteins. DNA Replication DNA molecule produces two new complementary strands. Each strand of the double helix of DNA serves as a template for.

Question of the DAY Jan 14 During DNA Replication, a template strand is also known as a During DNA Replication, a template strand is also known as a A.

1 RNA and Protein Synthesis. 2 The Function of DNA The DNA molecule contains all of your hereditary information in the form of genes. Genes are portions.

8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.

RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.

DNA. An organism’s genetic material Located on chromosomes Genes are segments on DNA Contains information needed for an organism to grow, maintain itself,

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

Genetics: RNA and Protein Synthesis

Protein Synthesis The formation of proteins based on information in DNA and carried out by RNA. (Gene expression) Flow of Genetic Information: DNA “unzips”

Notes: Transcription DNA vs. RNA

DO NOW EOC REVIEW PG 199 NAME THE 3 PARTS OF THIS STRUCTURE:

From DNA to Protein - Gene Expression: RNA and Protein

Protein Synthesis DNA RNA Protein.

Protein Synthesis.

12-3 RNA and Protein Synthesis

Transcription and Translation

DNA Transcription & Protein Translation

Biology Unit 4 Notes: RNA & Protein Synthesis

RNA and Protein Synthesis

Protein Synthesis.

Chp: 12 Transcription & Translation

Translation (Protein Synthesis) RNA  protein.

Protein Synthesis Lecture 5

RNA is a nucleic acid made of linked nucleotides.

RNA is a nucleic acid made of linked nucleotides.

Unit 6 Notes: PROTEIN SYNTHESIS & MUTATIONS

RNA, Transcription, and Translation

Gene Expression aka Protein Synthesis.

Transcription and Translation

RNA, Protein Synthesis, Transcription, and Translation

Protein synthesis.

Protein Synthesis.

Protein Synthesis.

TRANSLATION and MUTATIONS

The Production of Proteins by DNA

Presentation transcript:

PAP Biology Warm up Discuss at your table what protein synthesis is…….using the terms: transcription, translation, mRNA, rRNA, tRNA, codon, anticodon and ribosome.

Question #1 The process by which mRNA is decoded and a protein is produced.

Question #2 Sequence of three nucleotides that codes for one amino acid.

Question #3 Form of RNA that carries genetic information from the nucleus to the cytoplasm, where it serves as a template for protein synthesis.

Question #4 Identify the 4 amino acids that will be made from the following strand of mRNA…… GGG AUC CCA UUG

Question #5 Cell differentiation is determined by what biomolecule?

Question #6 A set of three nucleotides in a tRNA molecule that binds to a complementary mRNA codon during translation.

Question #7 Form of RNA that brings amino acids to ribosomes during protein synthesis.

Question #8 Process of copying a nucleiotide sequence of DNA to form a complementary strand of mRNA.

Question #9 Expression of genes can be prevented by different things that are in the ______________________.

Question #10 Identify the two mutations that cause a frameshift.

Question #11 Point mutations are also known as ________________ mutations.

Question #12 Where does transcription take place?

Question #13 What components of the DNA/RNA determine the genetic code?

Question #14 The ribosome is responsible for the production of proteins. What does it put together to make these proteins?

Question #15 What type of mutation is this: Normal = TACCCGTTACAGGCA Mutated =TACCCGTTACAGCAGCAGGCA

Question #16 What type of mutations is this: Normal = ACTCCTGAGGAG Mutated =ACTCCTGTGGAG

Question #17 Identify three difference between DNA and RNA.

Question #18 Identify the 4 nitrogen bases in RNA.

Question #19 Identify the following mutation: Normal = ATATTAGAACGCCTAGCA Mutated =ATAACGATCCGCAAGAATT

Question #20 What type of mutation has the most significant results?

Question #21 Write the DNA strand for the following strand of amino acids: Methionine – Tryptophan – Cysteine – Phenylalanine

Question #22 Transcribe the following DNA strand into RNA…..and then translate it into a protein. TAC CCG GGT AAC ACT

Question #23 Name the three types of RNA.

Question #24 A change in the DNA sequence.

Question #25 What are the base pairing rules?

Final Wager The genetic disorder cystic fibrosis occurs when the codon GUC is replaced with AUC. What type of mutations is this and what amino acid is being made now instead of valine?

Answers 1. Translation 2. Codon 3. Messenger RNA 4. Gly-Iso-Pro-Leu 5. Nucleic acid 6. Anticodon 7. Transfer RNA 8. Transcription 9. Environment 10. Deletion and Insersion 11. Silent 12. Nucleus 13. Nitrogen bases 14. Amino acids

Answers 15. Insersion 16. Substitution 17. Sugar (R & D), uracil/thymine, structure (one strand/double helix) 18. A U C G 19. Inversion 20. Frameshift 21. AUG–UGG–UGU(UGC) – UUU(UUC) 22. AUG-GGG-CCA-UUG-UGA Meth- Gly-Pro-Leu-Stop 23. mRNA, tRNA, and rRNA 24. Mutation 25. DNA= A pairs w/ T and G pairs w/C RNA= A w/ U, T w/ A and G pairs w/ C

Wager Substitution Isoleucine