Bell Work tRNA’s anticodons are complementary to mRNA’s codons when they meet in the ribosome, why is it important that they are the exact complement?

Slides:

Advertisements

Similar presentations

Protein Targetting Prokaryotes vs. Eukaryotes Mutations

Advertisements

Bellwork: Using the codon charts in your notes, fill in the boxes below. **Remember to use mRNA when doing translation**

HAPPY TUESDAY Bellwork: Study the Central Dogma, Transcription, & Translation. On Bellwork sheet write “Study for Quiz”.

DNA Mutations Biology 6(E).

Mutations Mutation- a change in the DNA nucleotide sequence

12.4 Mutations. Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription.

Mutations. DNA Mistakes DNA is a molecule that replicates, works and copies with very high accuracy DNA has enzymes that make sure that it works with.

Happy Tuesday! Bellwork: October 28 Write the following question and your answers on a bellwork page. In what organelle does transcription occur in the.

Ch Mutations Section Objectives:

Chapter 14 Homework is due on Sunday, January 25 at 11:59 pm The Chapter 13 and 14 test is on Monday.

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

Using a Codon Chart & Mutations Today’s Goal: Review codons and anticodons and describe several types of mutations. Quiz tomorrow over ch 12 and 13 material.

BELL WORK: You have five minutes to finish yesterday’s worksheets and turn them in.

Point Mutations Silent Missense Nonsense Frameshift.

Lesson Four Structure of a Gene. Gene Structure What is a gene? Gene: a unit of DNA on a chromosome that codes for a protein(s) –Exons –Introns –Promoter.

the Genetic Code Shown as mRNA 5′ → 3′ 64 codons Redundant

Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.

Happy Monday! Bellwork: October 26 Write the following question and your answers on a bellwork page. In what organelle does transcription occur in the.

CH Mutations in Genes Objectives: 1.Describe the following types of mutations: a.Base substitution b.Base insertion or deletion 2. Explain what can.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

Mistakes in the code. Review: What does DNA look like? How is DNA made? How does DNA instruct the cell to make proteins? What determines the order of.

Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology.

Bellwork: ***STUDY FOR VOCAB 4 QUIZ*** Using the codon charts in your notes, fill in the boxes below. **Remember to use mRNA when doing translation**

 BUILD-A-BUG ACTIVITY  Build your bug and turn in to your box  Mutations Notes  Mutations practice QUIZ NEXT CLASS: Transcription and Translation TUESDAY.

Mistakes in the code. Review: What does DNA look like? How is DNA for a new cell made? How does DNA instruct the cell to make proteins? What determines.

Gene: TTCGATCGC 1.Replicate 2.Transcribe 3.Translate 5/16/16 Date:5/16/16Topic:MutationsPage # ___ What sequences of amino acids do you end up with? Pass.

A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.

Variation among organisms

“How does it affect the protein?”

Gene Mutations.

A B C HAVE NOTECARDS OUT IN A STACK Transcription Replication

aspartate / aspartic acid

What sequences of amino acids do you end up with?

DNA Mutations Biology 6(E).

Types of Mutations.

Gene Mutations Chapter 11.

DNA and mutations SC.912.L.16.4.

Gene Mutations.

I can… Agenda Index Card Question HW Review Translation Notes

Types of point mutations

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

Homework: Study for midterm tomorrow

Entry Task Apply: Suppose a template strand of DNA had the following sequence: DNA: T A C G G A T A A C T A C C G G G T A T T C A A What would.

Entry Task Apply: Suppose a template strand of DNA had the following wild-type gene sequence: DNA: T A C G G A T A A C T A C C G G G T A T T C.

Mutations (Section 17-5) Now, that you know how gene expression works, let’s see how changes in the gene affect how the protein is made.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.

Distinguish between codon and anticodon.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

Mutation: Some Definitions

Mutation Notes.

Unit 1 Human Cells Higher Human Biology for CfE Miss Aitken

Mutations: Changes in Genes

Gene Mutations.

Presentation transcript:

Bell Work tRNA’s anticodons are complementary to mRNA’s codons when they meet in the ribosome, why is it important that they are the exact complement?

Test Thursday!

Cut out the notes and glue them on page 43 2:001:591:581:571:561:551:541:531:521:511:501:491:481:471:461:451:441:431:421:411:401:391:381:371:361:351:341:331:321:311:301:291:281:271:261:251:241:231:221:211:201:191:181:171:161:151:141:131:121:111:101:091:081:071:061:051:041:031:021:011:000:590:580:570:560:550:540:530:520:510:500:490:480:470:460:450:440:430:420:410:400:390:380:370:360:350:340:330:320:310:300:290:280:270:260:250:240:230:220:210:200:190:180:170:160:150:140:130:120:110:100:090:080:070:060:050:040:030:020:01End

Title: Mutations Page:43 Date: 10/26/15 Standard: Identify and Illustrate changes in DNA and evaluate the significance of these changes EQ: How Do Mutations of DNA Affect the Outcome of a Protein?

Mutations: changes in the genetic material caused by mistakes during replication, transcription, or due to environmental factors (radiation) Sickle Cell Anemia Color Blindness Crystal clear underwater vision! Crystal clear underwater vision Resistance to HIV

Two major types of mutations: Point Mutations (substitutions) A mutation that changes a single base Frameshift Mutations An insetion or deletion that affects the entire amino acid sequence

Normal DNA Phe Tyr AlaArg DNA mRNA

Silent: DNA mRNA PheTyr Ala Arg Even though a base changes, it does not cause a change in the amino acids Point Mutation

Missense: DNA mRNA PheTyr Gly Arg A base change causes a change in one amino acid Point Mutation

Nonsense: DNA mRNA PheStop Ala Arg A base change causes an early stop Point Mutation

Insertion: DNA mRNA Phe IsoCysThr A base is added and causes a change in all the amino acids after it Frameshift Mutation

Deletion: DNA mRNA Phe LeuHis A base is deleted and causes a change in all the amino acids after it Frameshift Mutation

Box new base RED Color new codons Green Color New amino acids purple or blue

Quick Write (notecard): Which is more likely to have a bigger effect on an organism, a point mutation or frameshift mutation? Explain why.