The 3 rd Research on Theorem Proving MEC Meeting Hanyang University Proteome Research Lab Hanyang University Proteome Research Lab 2003. 1. 16 Park, Ji-Yoon.

Slides:

Advertisements

Similar presentations

Uses of Cloned Genes sequencing reagents (eg, probes) protein production insufficient natural quantities modify/mutagenesis library screening Expression.

Advertisements

The genetic code.

Center for Biological Sequence Analysis Prokaryotic gene finding Marie Skovgaard Ph.D. student

Restriction Enzymes Lecture 15: 1 11/20/ Definition: enzymes that recognize specific double-stranded sequences and hydrolyze the phosphodiester.

 -GLOBIN MUTATIONS AND SICKLE CELL DISORDER (SCD) - RESTRICTION FRAGMENT LENGTH POLYMORPHISMS (RFLP)

ATG GAG GAA GAA GAT GAA GAG ATC TTA TCG TCT TCC GAT TGC GAC GAT TCC AGC GAT AGT TAC AAG GAT GAT TCT CAA GAT TCT GAA GGA GAA AAC GAT AAC CCT GAG TGC GAA.

Supplementary Fig.1: oligonucleotide primer sequences.

Gene Mutations Worksheet

Crick’s early Hypothesis Revisited. Or The Existence of a Universal Coding Frame Axel Bernal UPenn Center for Bioinformatics Jean-Louis Lassez Coastal.

1 Essential Computing for Bioinformatics Bienvenido Vélez UPR Mayaguez Lecture 5 High-level Programming with Python Part II: Container Objects Reference:

In vitro expression of BVDV capsid protein Corpus Christi College, University of Oxford Glycobiology Institute, Department of Biochemistry KOR SHU CHAN.

UALR Biosciences Core Facility High Throughput DNA Sequencing Fragment Analyses Real Time PCR In situ Hybridization Proteomics.

The Cloning of Atrolysin A from Crotalus atrox By AJ Goos & Kayla Ohrt.

Reading the blueprint of life DNA sequencing. Introduction The blueprint of life is contained in the DNA in the nuclei of eukaryotic cells and simply.

IGEM Arsenic Bioremediation Possibly finished biobrick for ArsR by adding a RBS and terminator. Will send for sequencing today or Monday.

MUTATIONS Definition: Any mistake or change in the sequence of DNA.

Application of MLVA-15 genotyping for typing of Brucella abortus isolates from India Dr. Gita Kumari.

 The following material is the result of a curriculum development effort to provide a set of courses to support bioinformatics efforts involving students.

Nature and Action of the Gene

Biological Dynamics Group Central Dogma: DNA->RNA->Protein.

Math 15 Introduction to Scientific Data Analysis Lecture 10 Python Programming – Part 4 University of California, Merced Today – We have A Quiz!

Undifferentiated Differentiated (4 d) Supplemental Figure S1.

Supplemental Table S1 For Site Directed Mutagenesis and cloning of constructs P9GF:5’ GAC GCT ACT TCA CTA TAG ATA GGA AGT TCA TTT C 3’ P9GR:5’ GAA ATG.

Lecture 10, CS5671 Neural Network Applications Problems Input transformation Network Architectures Assessing Performance.

Fig. S1 siControl E2 G1: 45.7% S: 26.9% G2-M: 27.4% siER  E2 G1: 70.9% S: 9.9% G2-M: 19.2% G1: 57.1% S: 12.0% G2-M: 30.9% siRNF31 E2 A B siRNF31 siControl.

PART 1 - DNA REPLICATION PART 2 - TRANSCRIPTION AND TRANSLATION.

Cloning of Atrolysin A from Crotulas atrox AJ Goos and Kayla Ohrt.

Antibiotic Resistance and Strategies to Develop New Antibiotics D. J. Kalita Associate Professor Department of Veterinary Biochemistry Faculty of Veterinary.

The 3 rd Research on Theorem Proving MEC Meeting Hanyang University Proteome Research Lab Park, Ji-Yoon.

Prodigiosin Production in E. Coli Brian Hovey and Stephanie Vondrak.

Passing Genetic Notes in Class CC106 / Discussion D by John R. Finnerty.

Supplementary materials

Dictionaries. A “Good morning” dictionary English: Good morning Spanish: Buenas días Swedish: God morgon German: Guten morgen Venda: Ndi matscheloni Afrikaans:

Comparative Evaluation of Three Extraction Methods for DNA Quantification and PCR Detection in Cocoa and Cocoa-Derived Products Lam Thi Viet Ha a, Lore.

Today House Keeping (schedule, PCRs 16S, COI) 30’.ppt talk Transfer of colonies Visit MBF 14.00h Complete transfer Intro editing chromatograms Edit and.

Suppl. Figure 1 APP23 + X Terc +/- Terc +/-, APP23 + X Terc +/- G1Terc -/-, APP23 + X G1Terc -/- G2Terc -/-, APP23 + X G2Terc -/- G3Terc -/-, APP23 + and.

Oligonucleotide-based Theorem Proving by Cross-Linking Gold Nanoparticle Assembly Park, Ji-Yoon.

The Molecular Theorem Proving with Hairpin Loop Structure MEC Seminar Park, Ji-Yoon.

RA(4kb)- Atggagtccgaaatgctgcaatcgcctcttctgggcctgggggaggaagatgaggc……………………………………………….. ……………………………………………. ……………………….,……. …tactacatctccgtgtactcggtggagaagcgtgtcagatag.

Example 1 DNA Triplet mRNA Codon tRNA anticodon A U A T A U G C G

이희두. Polymerase Chain Reaction  Technique widely used in molecular biology  With PCR it is possible to amplify a single or few copies of DNA across.

Topic: Replication of DNA Standard: Explain the role of DNA in storing and transmitting cellular information.

DNA, RNA and Protein.

Ji-Yoon Park Nanoparticle-Based Theorem Proving.

Copyright © 2007 American Medical Association. All rights reserved.

Nanoparticle-based Theorem Proving

Modelling Proteomes.

Wet (DNA) computing 2001년 9월 20일 이지연

Supplementary information Table-S1 (Xiao)

Sequence – 5’ to 3’ Tm ˚C Genome Position HV68 TMER7 Δ mt. Forward

Supplemental Table 3. Oligonucleotides for qPCR

GENE MUTATIONS aka point mutations © 2016 Paul Billiet ODWS.

DNA Implementation of Theorem Proving

Supplementary Figure 1 – cDNA analysis reveals that three splice site alterations generate multiple RNA isoforms. (A) c.430-1G>C (IVS 6) results in 3.

Huntington Disease (HD)

DNA By: Mr. Kauffman.

Tissue-Specific Reduction in Splicing Efficiency of IKBKAP Due to the Major Mutation Associated with Familial Dysautonomia Math P. Cuajungco, Maire Leyne,

Gene architecture and sequence annotation

Molecular engineering of photoresponsive three-dimensional DNA

DNA-based Theorem Proving - Present Work

A Missense Mutation (R565W) in Cirhin (FLJ14728) in North American Indian Childhood Cirrhosis Pierre Chagnon, Jacques Michaud, Grant Mitchell, Jocelyne.

Fundamentals of Protein Structure

Laboratory Acquired Infection with Recombinant Vaccinia Virus Containing an Immunomodulating Construct Martin Mempel, Gisela Isa, Norbert Klugbauer,

Station 2 Protein Synethsis.

Hanyang University Proteome Research Lab

Shailaja Gantla, Conny T. M. Bakker, Bishram Deocharan, Narsing R

Presentation transcript:

The 3 rd Research on Theorem Proving MEC Meeting Hanyang University Proteome Research Lab Hanyang University Proteome Research Lab Park, Ji-Yoon Park, Ji-Yoon

The 1 st Year Research - Linear Implementation

Advanced Proteome Research Lab(APRL) Advanced Proteome Research Lab(APRL) Theorem Proving using Resolution Refutation Nil, add R as

Advanced Proteome Research Lab(APRL) Advanced Proteome Research Lab(APRL) PrimerSequenceLengthModification GC Content ( % ) ST ¬ Q 5 ’ - AAG CAG TAG CGA CCA ATT GAC GCA AAT TGA CGT ACG TAC GCT GAA - 3 ’ 45 mer None46.7 ¬ RPQ 5 ’ - CAT ACA ATG AAC GCA GTC AAC GCA AGG CAG TTC AGC GTA CGT ACG - 3 ’ 45 mer None51.1 ¬P¬P¬P¬P 5 ’ - CTG CCT TGC GTT GAC - 3 ’ 15 mer 5 ’ -phosphate 60.0 R 5 ’ - TGC GTT CAT TGT ATG – 3 ’ 15 mer 5 ’ -phosphate 40.0 ¬S¬S¬S¬S 5 ’ - TGG TCG CTA CTT – 3 ’ 15 mer 5 ’ -phosphate 53.3 ¬T¬T¬T¬T 5 ’ - TCA ATT TGC GTC AAT-3 ’ 15 mer 5 ’ -phosphate 33.3 The Sequence for Linear Implementation

Advanced Proteome Research Lab(APRL) Advanced Proteome Research Lab(APRL) / /80 64/57/51/ 21/18/11/8 75 bp 75 bp M 1 2 The Amplification of Linear Molecule Fig 1. The amplification of linear molecule in 3% agarose gel electrophoresis Lane 1: PCR product with S and ¬R Lane 2: PCR products with ¬ S and R Lane M is a 25 bp molecular DNA ladder

The 2 nd Year Research - Hairpin Implementation

Advanced Proteome Research Lab(APRL) Advanced Proteome Research Lab(APRL) Sequence for Hairpin Implementation 5mer5mer 6 mer ¬P P ¬Q Q

Advanced Proteome Research Lab(APRL) Advanced Proteome Research Lab(APRL) Primer Sequence(5 ’ → 3’) LengthModification GC Content ( % ) P TATTAAGACTTCTTGTAGTCT TATTAAGACTTCTTGTAGTCT 21 mer 5 ’ -Phosphate 28.5 Q TCATGTTCCT TCATGTTCCT 10 mer 5 ’ -Phosphate 40.0 ¬P¬P¬P¬P TAATAAGGAA 10 mer 5 ’ -Phosphate 5 ’ -Phosphate20.0 ¬Q¬Q¬Q¬Q CATGA 5 mer 5 ’ -phosphate 40.0 ¬R¬R¬R¬R TCATGTTCCT 10 mer 5 ’ -phosphate 33.3 The Sequence for Hairpin Implementation

Advanced Proteome Research Lab(APRL) Advanced Proteome Research Lab(APRL) The Amplification of Hairpin Molecule Fig 2. The amplification of hairpin molecule in 3% agarose gel electrophoresis 50 bp 25 bp

The 3 rd Year Plan

Advanced Proteome Research Lab(APRL) Advanced Proteome Research Lab(APRL) Design of Problem 6 variables, 9 clauses 6 variables, 9 clauses

Advanced Proteome Research Lab(APRL) Advanced Proteome Research Lab(APRL) One of Proof Trees P 11 ∨ P 12 ~P 12 ∨ ~P 22 P 11 ∨ ~P 22 P 21 ∨ P 22 P 11 ∨ P 21 ~P 21 ∨ ~P 31 P 11 ∨ ~P 31 P 31 ∨ P 32 P 11 ∨ P 32 ~P 12 ∨ ~P 32 P 11 ∨ ~P 12 P 11 ∨ P 12 P 11 ~P 11 ∨ ~P 21 P 21 ∨ P 22 ~P 11 ∨ P 22 ~P 22 ∨ ~P 32 ~P 11 ∨ ~P 32 P 31 ∨ P 32 ~P 11 ∨ P 31 ~P 11 ∨ ~P 31 ~P 11 nil 20~30

Advanced Proteome Research Lab(APRL) Advanced Proteome Research Lab(APRL) Experimental Procedure The Problem (6var, 9clau) Design of Oligo Sequence Exonuclease III (remove partial solution) Step I Step II Step III Step IV Step V Hybridization (95°C→16°C cooling down) Synthesis & Modification (5’-Phosphate) Ligation (T4 DNA Ligase: 16°C Step VI Step VII Gel Electrophoresis Step VIII The Final Solution * No Self-Homology * No Cross-Homology

Advanced Proteome Research Lab(APRL) Advanced Proteome Research Lab(APRL) Forward Direction DNA9 Conference DNA9 Conference Abstract Submission(2/15) Abstract Submission(2/15) Experimental Work Experimental Work Journal Version Journal Version Biochemical Journal Biochemical Journal Biological Computing Biological Computing

Advanced Proteome Research Lab(APRL) Advanced Proteome Research Lab(APRL) Expected Result Fragments of linear DNA migrate through agarose gels with a mobility that is inversely proportional to the log 10 of their molecular weight Fragments of linear DNA migrate through agarose gels with a mobility that is inversely proportional to the log 10 of their molecular weight Circular forms of DNA migrate in agarose distinctly differently from linear DNAs of the same mass. Circular forms of DNA migrate in agarose distinctly differently from linear DNAs of the same mass.

Advanced Proteome Research Lab(APRL) Advanced Proteome Research Lab(APRL) Discussion