Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.

Slides:

Advertisements

Similar presentations

Any change in the DNA base sequence is called a mutation

Advertisements

Do Now Check, in your notes Replicate this DNA strand: CATCGG Transcribe this DNA strand in to RNA: CATAGG Write 3 differences between DNA and RNA.

DNA and Protein Synthesis DNA contains the genetic information to make amino acids Amino acids combine to make proteins These proteins determine the physical.

1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.

 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,

MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

To demonstrate understanding, after this lesson, you should be able to  define mutations  explain how mutations occur when – DNA Replication or Meiosis.

Mutations in DNA. Mutations A mutation is a change in a DNA sequence. Can happen if – There is a mistake in replication. – Bases change spontaneously.

Genetic Changes 11.3.

Ch Mutations Section Objectives:

Review: DNA, Transcription & Translation

Gene Mutations Chapter 11.

  Understand what mutations are  Understand how they occur  Analyze the different types of mutations  Understand how mutations affect amino acid.

Mutations Learning Goal: Identify mutations in DNA (point mutation and frameshift mutation caused by insertion or deletion) and explain how they can affect.

LS: I will be able identify and describe the different types of mutations.

Welcome to Genetic Mutations! 7x2WSY 7x2WSY.

DNA Mutations What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect Can be caused by: errors in.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

1.Most genetic disorders result from a mutation in one gene. a.Mutation: a change in an organism’s genetic material (DNA) 2.A mutated gene produces a.

Bell Ringer Where does translation occur in the cell? 2.Why do we need RNA to make proteins? 3.How can different codons code for the same amino.

DNA Mutations. Remember that during DNA replication, the DNA makes an exact copy of itself before it divides. DNA replication is not always accurate.

MUTATIONS Intro video

Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.

What is a codon? Above it shows how we read triplets, codons, and amino acids in a READING FRAME. For instance if we looked at the codons out of ‘reading.

4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.

BIOLOGY FALL 2014 MUTATIONS. WHAT ARE MUTATIONS? Mutations = changes in the genetic material Mutations can happen when cells make mistakes in copying.

Mutation Notes: Chapter 11.

11.3 Mutations.

Mermaid Syndrome Video.

Catalyst Create a circle map about mutations. Mutations.

Gene Mutations Chapter 11.

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Protein Synthesis.

Mutations LN #23 Ms. Garcia California Content Standard Genetics

Catalyst Create a circle map about mutations. Mutations.

To be successful today…

Chapter 11.6 When it all goes Wrong

DNA and Mutations.

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

Welcome to Genetic Mutations!

DNA and Mutations.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

1) Base Mutations 2) Chromosomal Mutations

C-Notes: Mutations Stnd: BI.4.c 10/23/13

I. Mutations A change in the genetic code

Mutations: Changes in Genes

Presentation transcript:

Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.

Changes in DNA Mutations: Any change in the genetic material of an organism. Can only be passed on if mutations happens in reproductive cells (sperm or egg). Caused by factors called mutagens Examples: radiation, chemicals and viruses.

Read sentence 1 and compare it to the others. 1. THE DOG BIT THE CAT 2. THE DOG BIT THE CAR. 3. THE DOG BII TTH ECA R. 4. THE DOB ITT HEC AR. a. What is wrong with sentence 2? b. How about # 3? # 4? c. Do #2, 3, 4 make sense? d. What would happen if these were mRNA codons? e. What is the term used for mistakes in DNA?

2 Types of mutations Point mutations: A change in one base pair Wrong base is inserted -usually change only one amino acid in a protein. Frame shift mutations Addition or deletion of a base EVERY amino acid that follows the mutation is changed Produces damaged protein

Result: Gene mutations may cause a change in a gene which can change the shape of a protein. This will have an effect on the way the protein works (if it still works at all).

Example of a mutation: Sickle Cell Anemia inherited form of anemia — a condition in which there aren't enough healthy red blood cells to carry adequate oxygen throughout your body.