CHMI 2227 - E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - replication.

Slides:

Advertisements

Similar presentations

DNA replication accuracy Balance between accuracy and mutation (to allow evolution) About 1 mistake per basepairs Achieved by accuracy of.

Advertisements

DNA Structure & Replication Chapter 15 continued Bedford County Public Schools – Jami N. Key.

1 Review of directionality in DNA Now, for DNA replication.

1 Replication of the Genetic Material Genetic material must be duplicated for transfer into daughter cells. Complementary double-stranded DNA makes this.

IB Topics 3 and 7.  DNA replication is a means to produce new molecules that have the same base sequence  Occurs during interphase of the cell cylce.

Chapter 13 DNA Replication.

Replication of Nucleic Acids. 2 Because sometimes this... 3.

DNA Replication. Synthesis Phase (S phase) S phase in interphase of the cell cycle. Nucleus of eukaryotes Mitosis -prophase -metaphase -anaphase -telophase.

DNA The Molecule of Life: Replication. Replication: Why? When cells replicate, each new cell needs it’s own copy of DNA. Where? Nucleus in Eukaryotes.

CHMI E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - replication.

AP Biology DNA Replication Ch.12.2 AP Biology DNA Replication  Purpose: cells need to make a copy of DNA before dividing so each daughter.

1. What experiment proved the semi- conservative replication nature of DNA? 2. What are the 3 steps of the DNA replication process? 3. What proteins help.

DNA Replication and Repair. How does DNA replicate? Mitosis and meiosis require DNA to replicate itself so that the daughter cells will contain DNA But.

Ch. 12.2: Replication of DNA Section objective:

DNA REPLICATION. What does it mean to replicate? The production of exact copies of complex molecules, such as DNA molecules, that occurs during growth.

Replication of DNA Objectives: 1. Summarize the roles of the different enzymes involved in replication of DNA. 2. Explain how the leading and lagging strands.

Animations/websites 878/student/animations/dna_replication/inde x.html

(b) Separation of strands

DNA Replication IB Biology HL 1 Mrs. Peters Spring 2014.

DNA Replication!.

DNA Replication. Replication of DNA Replication is the process where DNA makes a copy of itself. Why does DNA need to copy? Simple: Cells divide for an.

DNA Replication during cell division in eukaryotic cells, the replicated genetic material is divided equally between two daughter cells. it is important.

Part 3 DNA Replication Learning Targets 5. Understand base pairing and its role in replication, transcription and translation. 6. Understand that.

3.4 & 7.2 DNA Replication Pp 16 – 19 & Pp 58 – 60 &

Chromosomal Landscapes Refer to Figure 1-7 from Introduction to Genetic Analysis, Griffiths et al., 2012.

DNA Replication. Replication Occurs during cell division Must be accurate.

DNA replication Chapter 16. Summary of history Griffith Mice & Strep Transformation External DNA taken in by cell.

DNA Replication.

DNA REPLICATION 1) Semiconservative Replication According to this model, DNA Replication would create two molecules. Each of them would be a complex of.

DNA Replication 6.4. DNA Replication DNA replication is essential for cell division is DNA replication semi-conservative or conservative?

DNA Replication 6.4. DNA Replication DNA replication is essential in order for mitotic cell division to occur is DNA replication semi-conservative or.

INTERACTIVE NOTES PGS CHROMOSOMES & DNA REPLICATION.

DNA Replication 6.4. DNA Replication DNA replication is essential for mitotic & meiotic cell division Is DNA replication semi-conservative or conservative?

DNA Replication Pt Pgs. 188 – 189 Objective: I can describe in EXCRUCIATING detail how DNA is replicated. File:/dna-replication1.swf.

DNA Replication 17 September Note: On all figures: Template strand (parental DNA) in orange Primer strand (newly synthesized DNA) in red.

Do Now  What is replication?  Where does this take place?

The Molecular Basis of Heredity Chapter Nucleic acids store, transmit, and help express hereditary information.

DNA REPLICATION. Replication Facts DNA has to be copied before a cell divides DNA has to be copied before a cell divides DNA is copied during the S or.

DNA Replication.

BIOLOGY 12 DNA Replication.

21.4 DNA Replication The function of DNA in the cells is to

DNA Replication.

DNA Replication IB Topics 3 and 7.

The Molecular Basis of Heredity

Replication of DNA Notes & Animations.

DNA Replication.

Chapter 21 Nucleic Acids and Protein Synthesis

DNA Replication.

DNA Replication.

DNA REPLICATION Overview Information Chromosome Structure.

DNA Replication.

DNA Replication.

DNA Replication DNA is copied – this is called replication

Do Now!!  Why must DNA be replicated?

The Role of Enzymes DNA replication is carried out by a series of enzymes. They first “unzip” a molecule of DNA by breaking the hydrogen bonds between.

DNA REPLICATION AND REPAIR

BIOLOGY 12 DNA Replication.

DNA Replication.

DNA Replication.

DNA Replication.

12.2 Replication of DNA Objective:

Bidirectional Replication of a Circualr Chromosome

KEY CONCEPT DNA replication copies the genetic information of a cell.

DNA Replication Essential Question: How do enzymes help ensure DNA is copied correctly?

DNA REPLICATION.

KEY CONCEPT DNA replication copies the genetic information of a cell.

DNA replication Chapter 16.

DNA Replication.

The Molecular Basis of Heredity

Presentation transcript:

CHMI E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - replication

CHMI E.R. Gauthier, Ph.D.2 DNA replication Nucleus DNA

CHMI E.R. Gauthier, Ph.D.3 DNA replication 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’ 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’ 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’

CHMI E.R. Gauthier, Ph.D.4 DNA replication

CHMI E.R. Gauthier, Ph.D.5 Semi-conservative Conservative Dispersive Non-conservative DNA replication 1) Conservation of the parental strands

CHMI E.R. Gauthier, Ph.D.6 DNA replication 1) The Meselson and Stahl experiment PNAS 1958;44;

CHMI E.R. Gauthier, Ph.D.7 DNA replication 2) Directionality of replication Replication forks

CHMI E.R. Gauthier, Ph.D.8 DNA replication The replication fork 3’ Replication fork 5’ 3’ 5’ 3’ 5’ Direction of the replication fork

CHMI E.R. Gauthier, Ph.D.9 DNA replication Large DNA molecules can have multiple origins of replication

CHMI E.R. Gauthier, Ph.D.10 DNA replication 2) Directionality of replication 5’ 3’ 5’ 3’ 5’

CHMI E.R. Gauthier, Ph.D.11 DNA replication 2) Directionality of replication

CHMI E.R. Gauthier, Ph.D.12 DNA replication 2) Directionality: Okazaki fragments

CHMI E.R. Gauthier, Ph.D.13 DNA replication The replication fork

CHMI E.R. Gauthier, Ph.D.14 DNA replication 3) Nature of the replication machinery

CHMI E.R. Gauthier, Ph.D.15 DNA replication 3) DNA polymerase

CHMI E.R. Gauthier, Ph.D.16 DNA replication 3) DNA polymerase

CHMI E.R. Gauthier, Ph.D.17 DNA replication 3) DNA polymerase

CHMI E.R. Gauthier, Ph.D.18 DNA replication 3) DNA polymerase III of E. coli

CHMI E.R. Gauthier, Ph.D.19 DNA replication 3) DNA polymerase III of E. coli (Clamp loader) (DNA polymerase)

CHMI E.R. Gauthier, Ph.D.20 DNA replication 3) DNA polymerase III of E. coli

CHMI E.R. Gauthier, Ph.D.21 DNA replication 3) DNA polymerase III of E. coli Sliding clamp Put DNA Here! Direction of replication

CHMI E.R. Gauthier, Ph.D.22 DNA replication 3) Primase

CHMI E.R. Gauthier, Ph.D.23 DNA replication Initiation at the origin of replication

CHMI E.R. Gauthier, Ph.D.24 DNA replication Leading strand synthesis Unwinds DNA

CHMI E.R. Gauthier, Ph.D.25 DNA replication Lagging strand synthesis

CHMI E.R. Gauthier, Ph.D.26 DNA replication Lagging strand

CHMI E.R. Gauthier, Ph.D.27 DNA replication - DNA ligase Lacking Phosphodiester bond

CHMI E.R. Gauthier, Ph.D.28 DNA replication 4) Proofreading

CHMI E.R. Gauthier, Ph.D.29 DNA replication 4) Proofreading

CHMI E.R. Gauthier, Ph.D.30 DNA sequencing

CHMI E.R. Gauthier, Ph.D.31 PCR

CHMI E.R. Gauthier, Ph.D.32 PCR

CHMI E.R. Gauthier, Ph.D.33