Table S1. CD44 expression and clinicopathologic characteristics Cases (n=54) CD44 protein expression P value* Negativ e WeakStrong (n=8)(n=23) Age <60221129.

Slides:

Advertisements

Similar presentations

Legends for supplementary figures Fig s1. A: Western blot showing the suppression of SRp20 expression by Dox induction of SRp20 siRNAs in SKOV3 sublines.

Advertisements

Gene Expression And Regulation Bioinformatics January 11, 2006 D. A. McClellan

BME 130 – Genomes Lecture 7 Genome Annotation I – Gene finding & function predictions.

Figure S1: Diagram of alleles Figure S1: Vectors used to create transgenic and knock-in mice. A) Loxp-GFP/Stop-Loxp SB11 cDNA knocked into the Rosa26 locus.

Genetic Alterations of TP53 Gene in Brain Astrocytic Tumours Methodology Θ Eighty-three brain tumor biopsies were collected and used in this study. Thirty.

Kerrington Smith, M.D. CTOS Nov 14, 2008

Table S1. Characteristics of breast tumor and normal breast tissue samples. Relevant characteristics of breast tumor and normal breast tissue samples analyzed.

YUEMIN DING Neuro-oncology Group Department of Molecular Neuroscience

Supplemental figure Age (weeks) Up to 39 Systemic DMBA Tumor detection Collection A D C loxP AREx2-FAREx4-R Exon 4 Exon 2 Exon 3 Exon 2.

Age, SexHistologyPredominant subtype Pathological stage EGFR mutation CAF1 61, MaleAdenocarcinoma Solid predominant pT3N2M0 L858R CAF2 71, MaleAdenocarcinoma.

8.6 Gene Expression and Regulation TEKS 5C, 6C, 6D, 6E KEY CONCEPT Gene expression is carefully regulated in both prokaryotic and eukaryotic cells.

Supplementary table 1 Supplementary table 1. Clinical-pathological features of the resection-only and chemotherapy/resection stage II/III colorectal cancer.

Supplementary table 1 miR-506 expression and clinocopathological factors FactorsTotal number miR-506 low expressionmiR-506 high expression P-value (n =

Complexities of Gene Expression Cells have regulated, complex systems –Not all genes are expressed in every cell –Many genes are not expressed all of.

Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of.

Supplementary Table S1. Patient demographics of the RRBS discovery set. Characteristics RRBS discovery set TotalIDH1/2 WT IDH1 MUT No. of Patients

Oligo sequence for shRNA cloning TurboGFP shRNA upper strand CCGGCGTGATCTTCACCGACAAGATCTCGAGATCTTGTC GGTGAAGATCACGTTTTT TurboGFP shRNA bottom strand AATTAAAAACGTGATCTTCACCGACAAGATCTCGAGATC.

MRNASeq analysis using TCGA HNSC data Vinay Kartha Monti lab rotation project 11/25/2013.

Supplementary Table 1: Clinicopathologic characteristics of 100 patients with invasive breast cancer Clinical characteristicsNumber of cases (%) Median.

Supplementary Fig. 1. RT-PCR showed that tumor tissues have elevated Mst1 mRNA levels in most of the HCC patients tested. GAPDH RT-PCR products were shown.

Supplementary Figure 1. Generation of hepatocyte-specific A20 knockout mice. Targeting scheme. Diagram showing the LoxP-flanked (Floxed) and the deleted.

Ke Xu, Ph.D. Putuo Hospital and Cancer Institute,

Volume 204, Issue 1, Pages (January 2011)

Supplementary Table 1. (A) S100β Validation set (n=76 ER-positive and ER-negative patients). (B) S100β Validation set (n=59 ER-positive patients). Association.

Supplementary Figure S1 Generation of Nphp3G2A knock-in mice

EMT correlates with PERK but not IRE1 signaling in primary human tumors. EMT correlates with PERK but not IRE1 signaling in primary human tumors. A, two.

What does this protein make up or do? SA A

RNA and Protein Synthesis

Distinct Ezrin Truncations Differentiate Metastases in Sentinel Lymph Nodes from Unaffected Lymph Node Tissues, from Primary Breast Tumors, and from Healthy.

BMI (kg/m2) 　 <23, n (%) 23–25, n (%) ≥25, n (%) p value 177 (40.7)

Vav‐1 gene‐targeting strategy.

Volume 143, Issue 3, Pages e2 (September 2012)

EWS RNA-binding protein What does this protein make up or do?

ADAMTS-5 deficient mice do not develop mechanical allodynia associated with osteoarthritis following medial meniscal destabilization A.M. Malfait, J.

by Hiromi Gunshin, Carolyn N. Starr, Cristina DiRenzo, Mark D

Declan P. Lunny, Erica Weed, Patrick M

Supplementary table S1 by Shin et al.

Supplementary Figure 4. Comparisons of MethyLight and gene expression data. PMR values (X-axis) were plotted against log2 gene expression values (Y-axis)

Volume 154, Issue 6, Pages (September 2013)

Generation of γ1 EQ conditional knock-in mice.

Analysis of Tumor Cell Evolution in a Melanoma: Evidence of Mutational and Selective Pressure for Loss of p16ink4 and for Microsatellite Instability

RNA and Protein Synthesis

Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2

Volume 114, Issue 6, Pages (June 1998)

Naokazu Inoue, Ph. D. , Takao Nishikawa, M. S. , Masahito Ikawa, Ph. D

Cloning and Characterization of the Expression Pattern of a Novel Splice Product MIA (Splice) of Malignant Melanoma-derived Growth-inhibiting Activity.

The CD8α Gene Locus Is Regulated by the Ikaros Family of Proteins

W. Wang, T. Hayami, S. Kapila Osteoarthritis and Cartilage

Collagen-dependent phosphorylation of eIF4E in PDAC cells.

Supplementary Table 1. Summary of surface marker expression of adherent (A) and sphere-forming MRT cell lines (B), and primary tumors (C). A Sample CD146.

Rocco Ricciardi, Robert D. Madoff, David A. Rothenberger, Nancy N

Supplementary Table S2 Correlation between pre-operative plasma miR-451 or miR-486 concentrations and clinicopathologic features in gastric cancer patients.

Gene Structure.

Figure 1. Kidney-Specific Cre/loxP Recombination.

Enhanced expression of TLR7 protein in PBMCs from women.

Fig. 1. Generation of WNK3 knockout mice

Claudin 6 structure, distribution and transgenic phenotype.

Group Male Female Total Astrocytoma Grade 2 (%65)13 (%35)7 (%100)20

Table I Male Disc Participants: Mean (S.D.)

Volume 10, Issue 2, Pages (January 2015)

The expression of SPINDLIN1 in cancer tissues.

The Role of Erk1 and Erk2 in Multiple Stages of T Cell Development

SPDO isoforms are expressed differentially during development and in adult tissues. SPDO isoforms are expressed differentially during development and in.

Figure Results of duplication analysis and patient 11's chorein analysis and geographical distribution of VPS13A mutations Results of duplication analysis.

VEGF expression in neoplastic and normal prostate tissue.

Transcripts enriched and depleted in NB TICs compared with SKPs and other tumor tissues. Transcripts enriched and depleted in NB TICs compared with SKPs.

Supplemental Material

DNA constructs used for Dox-inducible expression of Axin and analyses of rtTA and Axin expression in transgenic mice. DNA constructs used for Dox-inducible.

Gene Structure.

Presentation transcript:

Table S1. CD44 expression and clinicopathologic characteristics Cases (n=54) CD44 protein expression P value* Negativ e WeakStrong (n=8)(n=23) Age < ≥ Gender Male Female24410 Tumor Stage I/II III/IV4004 Tissue Types Primary Tumor Metastases6006 Tumor Differentiation Well (Grade 1) Moderate (Grade 2) Poor (Grade 3) *P values were based on Fisher’s exact test. Table S1

Cases (n=54) KLF4 protein expression P value* NegativeWeakStrong (n=20)(n=24)(n=10) Age < ≥ Gender Male Female Tumor Stage I/II III/IV 4310 Tissue Types Primary Tumor Metastases 6600 Tumor Differentiation Well (Grade 1) Moderate (Grade 2)21795 Poor (Grade 3) Table S2. KLF4 expression and clinicopathologic characteristics *P values were based on Fisher’s exact test. Table S2

Primers Sequence (5' to 3') Tm ( ℃ ) Length (bp) mCD44-for5'-GGAGATCAGGATGACTCCTTCT-3'58345 mCD44-rev5'-AGTCCTTGGATGAGTCTCGATC-3' hCD44v-for5'-TCCCAGACGAAGACAGTCCCTGGAT-3'6387; 430 hCD44v-rev5'-CACTGGGGTGGAATGTGTCTTGGTC-3' h-GAPDH-for5'-ACCACAGTCCATGCCATCAC-3'62422 h-GAPDH-rev5'-TCCACCACCCTGTTGCTGTA-3' hCD44 (CHIP)-for5´-CAATCTCAAAAGGCTTCC -3´55335 hCD44 (CHIP)-rev5´-TTCATCTTCCCATACAAC-3´ hβ-actin-for5'-AGAAAATCTGGCACCACACC-3' hβ-actin-rev5'-CTCCTTAATGTCACGCACGA-3' mβ-actin-for5'-TTCTTTGCAGCTCCTTCGTT-3' mβ-actin-rev5'-GGGGTGTTGAAGGTCTCAAA-3' hESRP1-for5'-GACGGAGGACTGCAAAGAAG-3' hESRP1-rev5'-CATGAAGCTGCCCATCAGTA-3' hKLF4-for5'-GCTGGACCCCCTCTCAGCAATGG-3'63319 hKLF4-rev5'-ATCACAAGTGGGTGGCGGTCC-3' mKlf4 (loxp) -1exon 1, 5'-CTGGGCCCCCACATTAATGAG-3'61 425;296;172 mKlf4 (loxp) -2exon 2, 5'-TCGCTGACAGCCATGTCAGAC-3' mKlf4 (loxp) -3intron 3, 5'-CCAGCAGAGCCGTTCTGGCTG-3' Table S3. Specific primers for target and control genes Table S3

AntibodyCompanyCat#Dilution α-TubulinOncogeneCP06-100UG1:3000 β-actinSanta cruzSC-16151:3000 CD44 (F4)Santa cruzSC-99601:2000 CD44 (IM7)Santa cruzSC :500 CD133Santa cruzSC :1000 ESRP1SigmaHPA :500 E-cadherin (CDH1)BD pharmingen :2000 NanogSanta cruzSC :1000 KLF4ABGENTAm2725a 1:800 β-cateninCell signaling technology9587 1:2000 OCT4Cell signaling technology2750 1:2000 VimentinBD pharmingen :2000 VillinSanta cruzSC :1500 M2 (Anti-Flag)SigmaF3165 1:2000 Table S4. Antibodies for target and control protein expression in Western blot analyses Table S4