Synthetic Biology, ‘New Breeding Techniques’ GM & Genome Editing Ricarda A. Steinbrecher, PhD Econexus Oxford, 6 January 2016

–BioCAD software, –Robotic cloning, –Metabolic modelling, –Protein engineering, –DNA databases and registries, –Part and device libraries, –Regulatory circuits, –DNA synthesis, –Gene and genome assembly, –Genome editing: MAGE, CRISPR, TALENs, zinc fingers ** –Epigenetic engineering ** Microscopy, Molecular profiling Tools & technologies of Synthetic Biology

Predictability Microorganisms Plants Animals Human Precision Approach - designing and controlling biological processes - making organisms perform according to design of the outcome of our doing & intervention on all levels the dream of the realisation of precision ? invites a mechanistic approach and mindset (as we have insufficient knowledge)

Princeton School of Engineering and Applied Science

New Breeding Techniques under scrutiny by EC (are they GMOs??): 1) * Zinc Finger Nuclease Technology (ZFN-1/2/3) 2) * Oligonucleotide Directed Mutagenesis (ODM) 3) * Cisgenesis/Intragenesis 4) RNA-dependent DNA methylation (RdDM); 5) Grafting (onto a GMO rootstock); 6) Reverse Breeding (RB); 7) Agro-infiltration (both Agro-infiltration ‘sensu stricto’ & Agro-inoculation) (8 Synthetic genomics ) plus other NBTs mentioned by industry and interest groups: eg: MAS (marker assisted selection) - not GM !

distributed by EuropaBio

Metabolic pathways Metabolism is the set of chemical reactions that occur in a cell, which enable it to keep living, growing and dividing. Metabolic processes are usually classified as: catabolism - obtaining energy and reducing power from nutrients. anabolism - production of new cell components, usually through processes that require energy and reducing power obtained from nutrient catabolism.

ct: glycolysis - glucose oxidation in order to obtain ATP cb: citiric acid cycle (Kreb’s cycle): acetyl-CoA oxidation in order to obtain GTP and valuable intermediates. bl: AA degradation

metabolic map Organism = chemical factory  making different compounds according to design  utilise “precursors”  Change plumbing (genes)  “Petrol” in …. product out

cells nucleus chromosome DNA gene T A AA C C C G GG T TT A Basepairs: A-T & C-G (nucleotides)

Genes and Genetics: The Fundamentals “The New Genetics” 3. In many cases, more than one RNA/protein is produced from a given gene. DNA transcription RNA processing (alterations, splicing) mRNA translation protein 3D Protein

Gene & gene construct promoter Gene for trait (Bt toxin) end Regulatory sequence: on/off switch - often CaMV (virus) Coding sequence of a gene - e.g. pat or bar gene for herbicide resistance from soil bacteria Regulatory sequence: Termination signal - e.g. from pea Plasmid backbone DNA, superfluous genetic material

Transformation No control of where the gene will insert itself: Random integration Imprecision (incl. superfluous DNA) s of Mutations (Sala et al. 2000, Wang et al. 1996, Labra et al 2001) ? Agrobacterium used as “shuttle” Particle bombardment

Targeted ‘break’ of both strands of DNA in a chromsome Special enzyme

The special enzymes are called: 1.CRISPR/Cas 2.ZFN (zinc finger nucleases) 3.Tales/Talens (transcription activator–like effector nucleases) 4.Meganucleases 9/35

Synthesis “Computer, give me 1000 variants” – put into 1000 organisms A A T T C C G G ACGTTTTAACGTTTACGGGT … … A A A A A A A A C C C C C C G G G G G G G G T T G G T T T T T T T T T T T T A A C C

Two separate breaks result in large deletion of material Material ‘deleted’ 6/35

the double-stranded break results in degradation of both strands by endogenous enzymes, enlarging the area of damage the damage can be repaired by rejoining (leaving a deletion or other change), by a template-directed repair (that may change function) or a template-directed insertion

Unpredictabilities and risks - Off-target effects (due to non-specific binding to non- target DNA): off-target mutations in the genome. These mutations can a) if in the coding sequence, result in changes of function of proteins, or b) if in regulatory sequences, result in changes in the expression of genes, such as increased presence of plant toxins, or absence of proteins important for nutrition, plant defence or disease resistance, increased presence of allergens. - Integration of added DNA or oligonucelotides into the genome - Impacts of the genetic engineering processes (mutations) Steinbrecher, R (2015). Genetic Engineering in Plants and the “New Breeding Techniques” (NBTs) - Inherent risks and the need to regulate.

The idea of precision is based on that one knows what one is doing – here this is not the case. Knowledge & precision at the level of nucleotides is only the bottom layer. What is missing is the contextualisation into the genome the epigenetic landscape the organism the ecosystems the socio-economic conditions that differ around the world Precision around nucleotides gives a false sense of predictability and safety – there is no data to support such extrapolations. The idea of Precision

thank you

Push Pull Technology – East Africa Problem for maize yield: Stem borer (eg chilo partellus moth) effect a third of the region’s maize crop. Scientists of the Mbita Point Research Station, Lake Victoria, Kenya came up with a simple solution: Pull: Napier grass (up to 70% yield increase). Push: Desmodium, a common legume “weed” species, repels the stem borer Secondary benefits: Desmodium enriches soil with nitrates, prevents soil erosion during rains and suppresses the growth of Striga weed, a parasitic plant causing US$ 10 billion yield loss/year (effecting 100 million Africans). Napier grass can be used and sold as fodder.

GE vs. Alternatives in Developing Countries

Locally researched Solutions already Exist

GE vs. Alternatives in Developing Countries

“Biomass doesn’t cut it.. Carbohydrates are not a substitute for oil. I was wrong in that and I admit it. That will never replace oil because the economics don’t work. You can’t take carbohydrates and convert them into hydrocarbons economically” Alan Shaw (formerly Codexis)