Translation & Mutations. IV.How to Make Proteins: *DNA goes through Transcription to make mRNA. The mRNA works with tRNA and rRNA to make proteins in.

Slides:

Advertisements

Similar presentations

Cell Division, Genetics, Molecular Biology

Advertisements

Translation (Protein Synthesis) RNA  protein. Making a protein Many RNAs needed –mRNA, tRNA, rRNA.

Ribonucleic Acid (RNA) & Protein Synthesis Ms. Napolitano & Mrs. Haas CP biology.

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

Making of Proteins: Transcription and Translation

Protein Synthesis Mrs. Gamari. Flow of Genetic Information Gene  segment of DNA that codes for a hereditary character (PROTEIN) DNA  RNA  protein PROTEINS.

RNA & Protein Synthesis Chapter 13. DNA A book of instructions that tells each individual what proteins to make for their needs. The path from genes to.

Making Proteins From DNA to Protein. What is transcription? Transcription = The process of making RNA from DNA’s instructions.

Chapter 13: RNA and Protein Synthesis

RNA and Protein Synthesis

Part Transcription 1 Transcription 2 Translation.

DNA to Proteins 3-4.

CFE Higher Biology DNA and the Genome Translation.

 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (__________) codes for a particular.

General Biology Notes TRANSLATION A.K.A. PROTEIN SYNTHESIS

Protein Synthesis The majority of genes are expressed as the proteins they encode. The process occurs in 2 steps: 1. Transcription (DNA---> RNA) 2. Translation.

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

DNA / RNA. tRNA rRNA mRNA 5’ 3’ Types of RNA Transcription: transfer of information from DNA to RNA in the nucleus  In the process of transcription.

Use the SUMMARY OF PROTEIN SYNTHESIS handout during this section of notes.

 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (GENE) codes for a particular protein;

Sections 3-4. Structure of RNA Made of nuleotides Three differences between DNA & RNA Sugar DNA = deoxyribose sugar RNA = ribose sugar RNA is single stranded.

The Components and Structure of DNA

RNA & DNA Compare RNA & DNA Contrast RNA & DNA

RNA AND PROTEIN SYNTHESIS

Amino acids are coded by mRNA base sequences.

The Genetic Code and Translation. Codon – three mRNA bases in a row that code for an amino acid Divide this mRNA strand into codons: AUGGGCACUCUCGCAUGA.

Chapter Translation. Review:  Recall that at the end of transcription, RNA (mRNA, rRNA, and tRNA) are produced, they detach from the DNA, and enter.

Decoding the message. DNA and RNA work together to produce proteins Remember: A protein is a specific sequence of amino acids.

CHAPTER 13 RNA and Protein Synthesis. Differences between DNA and RNA  Sugar = Deoxyribose  Double stranded  Bases  Cytosine  Guanine  Adenine 

12.3 Protein Synthesis (Translation). Watch these animations and try to explain what is going on. ◦Animation 1Animation 1 ◦Animation 2Animation 2.

Protein Synthesis. RNA (RIBONUCLEIC ACID)  Nucleic acid involved in the synthesis of proteins  Subunits are nucleotides  Nucleotides are composed of.

Protein Synthesis How genes work.

DNA, RNA, PROTEIN REVIEW. 1. What are all living things made of? 2. In what organelle is the genetic material located? 3. What is the name of the molecule.

8.5 Translation KEY CONCEPT Translation converts an mRNA message into a protein.

RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.

RNA & Protein Synthesis Continued: Translation. Translation: mRNA Protein Translation is taking mRNA and making proteins Sequence of nucleotide bases.

Chapter 13 GENE FUNCTION. A. Comparison of DNA & RNA.

Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

Protein synthesis continued.  Transcription is step 1  DNA  mRNA  Nucleus  RNA polymerase.

Ribosomes and Protein Synthesis

Protein Synthesis Translation.

TRANSLATION NOTES.

Transcription Part of the message encoded within the sequence of bases in DNA must be transcribed into a sequence of bases in RNA before translation can.

Step 3 in Protein Synthesis

Translation and Protein Synthesis

Gene Expression Continued

Transcription and Translation

Daily Warm-Up Dec. 12th Transcribe this DNA segment

Amino Acid Activation And Translation.

Ch. 12 Protein Synthesis.

Translation (Protein Synthesis) RNA  protein.

TRANSLATION NOTES.

Transcription From DNA to RNA. Transcription From DNA to RNA.

Protein Synthesis Translation

Steps to Protein Synthesis

RNA - TRANSLATION.

Unit 7: Molecular Genetics

GENE EXPRESSION / PROTEIN SYNTHESIS

Ch Protein Synthesis Protein Synthesis Proteins are polypeptides

Protein synthesis.

Translation: Protein Synthesis

Transcription Using DNA to make RNA.

The Genetic Code and Translation

TRANSLATION and MUTATIONS

Video 3D visual

Presentation transcript:

Translation & Mutations

IV.How to Make Proteins: *DNA goes through Transcription to make mRNA. The mRNA works with tRNA and rRNA to make proteins in Translation

A.Protein Structure 1.Proteins are made of amino acids, linked together in chains. There are 20 amino acids. 2.The sequence of amino acids determines how the protein will twist and fold into a 3D shape. 3.A chain of amino acids is a polypeptide.

B.Genetic Code – a sequence of mRNA nucleotides (bases) can be translated into a sequence of amino acids 1.3 mRNA nucleotides is called a codon. 2.Each codon codes for 1 specific amino acid.

3.There are two special codons: a)Start Codon – 3 mRNA nucleotides with the bases AUG. This codon triggers a ribosome to begin translation. AUG codes for the amino acid methionine, so this is the first amino acid of every protein. b)Stop Codon – 3 mRNA nucleotides with bases UAA, UAG, or UGA. This codon tells a ribosome to stop translating mRNA.

4.tRNA: one end holds an amino acid & the other end is an anticodon. The anticodon is three bases complementary to the bases on the mRNA. Ex: mRNA: CAU GGA tRNA anticodon: GUA CCU

V.Translation – taking mRNA, “reading” it to bring the correct amino acids and connect them to make a protein. 1.mRNA is made from a single strand of DNA in the nucleus (transcription). 2.mRNA is carried from the nucleus to the cytoplasm. 3.mRNA goes to a ribosome (rRNA). The ribosome attaches to the start codon.

4.A tRNA attaches to an amino acid in the cytoplasm and carries it to the mRNA and ribosome. 5.Each tRNA lines up its anticodon with the codon on the mRNA (base-pairing rules). *For example, if the mRNA codon is CCU, the anticodon on the tRNA will be GGA. Now the amino acid at the other end of the tRNA is in the right position to form an amino acid chain.

6.Amino acids are connected to make a protein. 7.When a stop codon is reached, no amino acid is added. The mRNA, ribosome, tRNA’s, and protein are released into cytoplasm.

Mutations - changes in DNA sequence I.Gene Mutations: result from changes in a single gene A.Point Mutations: affect 1 DNA nucleotide 1.Also called substitutions, as 1 DNA nucleotide is substituted for another

B.Frameshift Mutations: shift the “reading frame” of the genetic message Insertion Deletion

II.Chromosomal Mutations: changes in the # or structure of chromosomes A.Deletion: loss of all or part of a chromosome B.Duplication: segment of a chromosome is repeated C.Inversion: part of a chromosome becomes oriented in reverse directions D.Translocation: part of 1 chromosome breaks off and attaches to another chromosome

Chromosomal Mutations