MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Slides:

Advertisements

Similar presentations

DNA (Gene) Mutations.

Advertisements

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

Mutation and Genetic Change

Section DNA: The Molecule of Heredity

1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.

DNA (Gene) Mutations. What is a gene mutation? Parts of DNA will have a base (or more) missing, added, or incorrect A mistake in the genetic code Wrong.

 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,

MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

C11- DNA and Genes Chapter 11.

Mutations Chapter 12.4.

Genetic Changes 11.3.

Mutations Genetic Changes.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

Review: DNA, Transcription & Translation

Genetic Mutations. Mutations Mistakes made in the DNA sequencing They can have a range of effects. They can affect the genetic information that is passed.

Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?

Section 11.3 Genetic Changes.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.

  Understand what mutations are  Understand how they occur  Analyze the different types of mutations  Understand how mutations affect amino acid.

MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.

Mutations that happen during Transcription and Translation

DNA Mutations What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect Can be caused by: errors in.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

Ch Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations.

Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

Chapter 11 DNA. What is DNA? Living things need proteins to survive. –most proteins are enzymes DNA provides the complete set of instructions for making.

13.3 Mutations. POINT > Define a gene in simple terms POINT > Define and describe genetic mutations POINT > Distinguish between gene and chromosomal mutations.

From DNA to Protein. Proteins Proteins are complex 3D structures that play a key role in cell function. All controlling enzymes are made out of protein.

Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.

DNA Mutations. Remember that during DNA replication, the DNA makes an exact copy of itself before it divides. DNA replication is not always accurate.

MUTATIONS  Several things can go wrong when DNA replicates.  Mutations.

Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.

12.4 Mutations.  What is a mutation and where can it occur? Inheritable change in genetic code 99.9 % are harmful, only 0.1% are helpful  Any change.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.

Mutation Notes: Chapter 11.

Section 11.3: Genetic Changes

12.4 Assessment Answers.

Mutations 6/26/2018 SB2d.

11.3 Mutations.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

A change in the DNA sequence that affects genetic information

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Mermaid Syndrome Video.

Genetic Mutations.

Protein Synthesis.

A change in the DNA sequence that affects genetic information

Mutations LN #23 Ms. Garcia California Content Standard Genetics

11.3 Section Objectives – page 296

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

Mutations A mutation is any change in the DNA sequence.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Genetic Mutations Karyotype: the number and visual appearance of the chromosomes in the cell nuclei of an organism or species.

Mutations A mutation is any change in the DNA sequence.

10th Grade Biology Mr. Walker

11.3 Section Objectives – page 296

Presentation transcript:

MUTATIONS

Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or cause functional problems in cells… may cause fatality –Can have positive effects (rare) which lead to evolution In Body Cells: impairs the function of the cell; mutation passed on to daughter cells, NOT offspring! –Mutations in genes that control cell division = cancer!!!

Point Mutations Point Mutation: A change in a single nitrogen base in DNA Can change one amino acid, which changes the entire structure of a protein Can create a stop codon in the wrong place Example: –THE DOG BIT THE CAT –THE DOG BIT THE CAR

Point Mutations

Frameshift Mutation When a single base is added or deleted from DNA This shifts the reading of codons by one base Causes a change in nearly ALL the amino acids following the mutation Example: –THE DOG BIT THE CAT –THE DO_ BIT THE CAT (Deletion of G) –THE DOB ITT HEC AT

Frameshift Mutation

Chromosomal Mutations Mutation that occurs at the chromosome level, resulting in changes in gene distribution to sex cells (gametes) during meiosis. Caused when parts of chromosomes break off and rejoin incorrectly Can cause there to be too many or not enough chromosomes in our sex cells 4 Types: Deletions, Insertions, Inversions, Translocations

Chromosomal Mutations

Causes of Mutations Mutations can be caused by either internal factors or external environmental factors. Spontaneous mistakes can occur during replication, transcription, and/or translation causing a variety of mutations. Mutagens are factors in the external environment that cause changes in the DNA sequence.

Causes of Mutations –Radiation High energy rays “blast” DNA apart. Mutations occur as these sections reform. X-rays UV rays Nuclear radiation

Causes of Mutations –Chemicals Asbestos- used in houses because is resistant to heat, causes mesothelioma, cancer in the lining of the lungs. Formaldehyde- shown to cause lung cancer in rats and possibly in humans.

Repair of Mutations Enzymes act as editors to proofread the DNA and make corrections. Limited exposure to external mutagens is the best protection against mutations Base-pairing Mistake Enzyme cuts out the damaged DNA segment Another enzyme fills in the missing nucleotides. The new nucleotides are sealed in, completing the DNA strand.