Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

Slides:



Advertisements
Similar presentations
Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)
Advertisements

Genes and mutations. What are genes? A molecular unit of heredity The name for stretches of DNA and RNA that code for a specific protein (which has a.
1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.
 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,
12-4 Mutations Mutation: A Change in DNA Mutation – any change in the DNA sequence that can also change the protein it codes for Mutations in Reproductive.
MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.
Section 11.3 MUTATIONS Section 11.3 pgs
Mutations Chapter 12.4.
Genetic Changes 11.3.
Mutations Genetic Changes.
Genetic Mutations Increasing Genetic Diversity May 4, 2010.
Ch Mutations Section Objectives:
Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?
Section 11.3 Genetic Changes.
1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.
MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.
MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.
Mutations. What comes to mind???? Mutants.
Sometimes replication, transcription and translation don’t go as planned! Replication, Transcription, and Translation errors result in mutations. A mutation.
DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.
Mutations that happen during Transcription and Translation
DNA (Gene) Mutations. What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect.
Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.
Ch Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations.
MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.
MUTATIONS. Mutant An organism expressing a mutated gene.
12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.
From DNA to Protein. Proteins Proteins are complex 3D structures that play a key role in cell function. All controlling enzymes are made out of protein.
Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.
Mutations.
Mutation Notes: Chapter 11.
Gene Expression and Regulation and Mutations
Section 11.3: Genetic Changes
12.4 Assessment Answers.
Mutations.
Mutation Notes Chapter 12-4.
Mutations.
11.3 Mutations.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
A change in the DNA sequence that affects genetic information
Mutations.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
Mermaid Syndrome Video.
Copyright Pearson Prentice Hall
What happens when things go wrong?
DNA Mutations & Disorders
Bell Ringer: 11/21/17 Objective: Explain that mutations occur during DNA replication or transcription and may be random or a result of environmental agents.
Genetic Mutations.
A change in the DNA sequence that affects genetic information
Mutations LN #23 Ms. Garcia California Content Standard Genetics
11.3 Section Objectives – page 296
Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
Mutations.
4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.
Mutations A mutation is any change in the DNA sequence.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Genetic Mutations Karyotype: the number and visual appearance of the chromosomes in the cell nuclei of an organism or species.
Mutations changes in genetic material (_____).
Mutations A mutation is any change in the DNA sequence.
DNA Mutations.
10th Grade Biology Mr. Walker
Mutation, Natural Selection, and Artificial Selection
11.3 Section Objectives – page 296
Mutations.
Genetic Mutations.
Presentation transcript:

Mutations

Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects include: production of a new trait, a dysfunctional protein, lethal, or positive effects (evolution)

Mutation effects Body Cells - change in the DNA sequence of a body cell (liver cell, skin cell etc) -not passed on to offspring (only affects the individual) -possible effects include: may damage the function of that cell – Ex: a stomach cell that loses the ability to make acid for digestion, when the cell divides, the mutation continues

Types of mutation Point mutation =a change in a single base pair in DNA

Point mutation effects possibly the wrong amino acid is made so the function of the protein could be messed up

Types of mutations Frameshift mutation = a single base is added or deleted from the DNA sequence which causes a shift in the reading of the codons

Frameshift mutation effects Possible effects: all amino acids after the addition or deletion are wrong SO much worse!

Types of mutations Chromosomal mutation = a change in a chromosome (part is broken off or parts switch places) Examples: – deletion – insertion – inversion – translocation Possible Effects: offspring usually dies; if not the offspring is sterile

Causes of mutations Spontaneous- mistakes during base pairing (transcription) Mutagen= any agent that can cause a change in DNA – Ex: 1. Radiation (Xrays, UV light) 2. Chemicals (asbestos, cyanide, formaldehyde) 3. High Temperatures