Biology Mistakes in the Genetic Machine

Terms for Section 6 Gene regulation Mutation Point mutation Frameshift mutation Mutagen

Oops! Mistakes can occur during DNA replication MUTATION: A change in a cell’s DNA Unless mistake is fixed, nothing may happen, or something good or bad can occur

Types of Mutation POINT MUTATION: When a single nucleotide is changed into a diff. one – Normal code would read: THE BIG FAT CAT ATE THE WET RAT – Point mutation that can cause diff. a.a. THE BIZ FAT CAT ATE THE WET RAT – Point mutation can cause early stop to translation THE BIG RAT

FRAMESHIFT MUTATION: Reading of the code is “shifted” up or down mRNA strand Two types of frameshift – Frameshift: Insertion An extra nucleotide added into the code THE BIG ZFA TCA TAT ETH EWE TRA – Frameshift: Deletion removes a nucleotide THB IGF ATC ATA TET HEW ETR AT

Point Mutation Frameshift Mutation Point and Frameshift Mutations

Mutations can occur when the chromosome is altered – Whole segments of chromosome, which includes large amounts of genes, can be deleted, duplicated, inverted, even translocated – Think chapters in a book, not a single letter or word Chromosomal Mutations

Deletion

Duplication

Inversion

Translocation

End Result? Mutations in somatic cells (cells that are not sperm or egg) are passed down to daughter cells but NOT TO AN ORGANISM’S OFFSPRING Mutations in sex cells may be passed down to offspring – Cri-du-chat, or “Cry of the Cat”, is caused by the passing down of chromosomes with deleted segments – These types of mutations may cause miscarriages or failure for embryo to develop (death)

MUTAGEN: Substances which cause mutations – Chemicals and radiation Most point mutations that occur happen in non-coding regions, having no positive or negative effects Some mutations can cause novel traits to appear Some cause problems such as cancer or cystic fibrosis

Deletion Duplication Translocation Inversion

Section 6 Questions Transcribe a mRNA strand from this DNA strand and THEN tell me the amino acid sequence translated from it – GTTCTACGGATCCGAACGCACTTTGCC Identify the type of mutation that occurs from this original DNA Sequence (TTCAATGGGTACTG) and describe what happened – Mutation one: TTCAATGGGCTACTG – Mutation two: TTCAATGGCTACTG – Mutation three: TTCATGGGTACTG When a nucleotide is substituted for another, will it necessarily change the amino acid? Explain.

Compare and contrast DNA and RNA using a Venn diagram. Identify the following CHROMOSOME ERRORS as deletion, inversion, translocation, or duplication. These are CHROMOSOMES AGAIN! (original chromosome: ABCDEFG) – ABCDCDEFG – ABCDEFGXYZ – ABEFG – ABCDGFE