Archaeology/paleontology (“ancient DNA” analysis) Conservation biology Forensic science Taxonomy Power & pitfalls of PCR (polymerase chain reaction) Rapid.

Slides:



Advertisements
Similar presentations
Population Genetics 3 We can learn a lot about the origins and movements of populations from genetics Did all modern humans come from Africa? Are we derived.
Advertisements

Y CHROMOSOME VARIATION Males from Cis-Baikal Sites of Lokomotiv, Shamanka II, and Ust’-Ida Examine the genetic relationships between prehistoric Cis- Baikal.
Vicky Lee.  The Descent of Man “In each great region of the world the living mammals are closely related to the extinct species of the same region. It.
From Africa to Aotearoa The story of human migrations.
Recovery and analysis of old/ancient DNA: molecular archaeology/anthropology Why study ancient DNA (aDNA)? Obtaining aDNA Early studies of aDNA Guidelines.
Molecular Evolution. Morphology You can classify the evolutionary relationships between species by examining their features Much of the Tree of Life was.
Homo floresiensis Pierolapithecus catalaunicus Great-great-grandfather ape. A new fossil (reconstruction, above, and face, inset) may be closely related.
By Peter Malinski. Mammoths are an extinct species that lived during the Pleistocene as recently as 10,000 years ago. Some mammoths have been recovered.
1 African Populations and the Evolution of Human Mitochondrial DNA Vigilant L., Stoneking M., Harpending H., Hawkers K. and Wilson A. C. Science, New Series,
Phylogenetic Trees Systematics, the scientific study of the diversity of organisms, reveals the evolutionary relationships between organisms. Taxonomy,
Phylogenetic Trees Understand the history and diversity of life. Systematics. –Study of biological diversity in evolutionary context. –Phylogeny is evolutionary.
Classification of Living Things. 2 Taxonomy: Distinguishing Species Distinguishing species on the basis of structure can be difficult  Members of the.
PHYLOGENY AND SYSTEMATICS
Sequencing Neanderthal DNA
Explain how crime scene evidence is
Molecular Clock I. Evolutionary rate Xuhua Xia
Cloning lab results Cloning the human genome Physical map of the chromosomes Genome sequencing Integrating physical and recombination maps Polymorphic.
T 5/5 exam #3 (bring cheat sheet) Sat. 5/9 optional final exam, 9am-noon.
Review of cladistic technique Shared derived (apomorphic) traits are useful in understanding evolutionary relationships Shared primitive (plesiomorphic)
Genetica per Scienze Naturali a.a prof S. Presciuttini Human and chimpanzee genomes The human and chimpanzee genomes—with their 5-million-year history.
Tracing the dispersal of human populations By analysis of polymorphisms in the Non-recombining region of the Human Y Chromosome Underhill et al 2000 Nature.
Neandertal mtDNA evidence: reported 1997 Dr. Svante Pääbo (Max Planck Institute for Evolutionary Anthropology). mtDNA sequence from type specimen of “neanderthalensis”
Evolutionary Genome Biology Gabor T. Marth, D.Sc. Department of Biology, Boston College Medical Genomics Course – Debrecen, Hungary, May 2006.
BIOE 109 Summer 2009 Lecture 13- Part II Human evolution.
New polymerases for old DNA: molecular breeding of polymerases for damage bypass and ancient DNA amplification Philipp Holliger MRC Laboratory of Molecular.
Topic : Phylogenetic Reconstruction I. Systematics = Science of biological diversity. Systematics uses taxonomy to reflect phylogeny (evolutionary history).
Ferris et al PNAS 1981 Evolutionary tree of apes and humans based on cleavage maps of mtDNA Figure compares restriction fragments in humans and gorillas.
Out-of-Africa Theory: The Origin Of Modern Humans
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Human Mitochondrial DNA. 1 st Review: Cell Theory All organisms are composed of cells. All cells come from preexisting cells The cell is the basic unit.
DNA basics DNA is a molecule located in the nucleus of a cell Every cell in an organism contains the same DNA Characteristics of DNA varies between individuals.
 Archaeology – “the scientific study of material remains (as fossil relics, artifacts, and monuments) of past human life and activities”  Studies.
Analyzing DNA Differences PHAR 308 March 2009 Dr. Tim Bloom.
Classification and Systematics Tracing phylogeny is one of the main goals of systematics, the study of biological diversity in an evolutionary context.
Generating Diversity: how genes and genomes evolve Erin “They call me Dr. Worm” Friedman 29 September 2005.
DNA FINGERPRINTS. No two people in the world have the same DNA (except Identical twins) A majority of DNA is actually the same for all humans. About 0.10.
Background Information First species of Homo, Homo habilis, evolved in Africa around 2 million years ago. Later, a descendant of Homo habilis, Homo erectus.
20.1 Structural Genomics Determines the DNA Sequences of Entire Genomes The ultimate goal of genomic research: determining the ordered nucleotide sequences.
APPLICATIONS OF MOLECULAR PHYLOGENETICS
Biology 101 DNA: elegant simplicity A molecule consisting of two strands that wrap around each other to form a “twisted ladder” shape, with the.
APPLICATIONS OF MOLECULAR PHYLOGENETICS
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Discuss results of forensics analysis Review mini satellites and microsatellites Present Y chromosome study of human origins and migration Discuss one.
Population Genetics and Human Evolution
Chapter 12 Bioarchaeological Approaches to the Past.
Chapter 24: Molecular and Genomic Evolution CHAPTER 24 Molecular and Genomic Evolution.
Models of Molecular Evolution III Level 3 Molecular Evolution and Bioinformatics Jim Provan Page and Holmes: Sections 7.5 – 7.8.
PHYLOGENY and SYSTEMATICS CHAPTER 25. VOCABULARY Phylogeny – evolutionary history of a species or related species Systematics – study of biological diversity.
Neanderthals Noonan, et al. Sequencing and Analysis of Neanderthal Genomic DNA Green, et al. Analysis of one million base pairs of Neanderthal DNA Kristine.
Molecular and Genomic Evolution Getting at the Gene Pool.
Cédric Notredame (08/12/2015) Molecular Evolution Cédric Notredame.
Chapter 10 Phylogenetic Basics. Similarities and divergence between biological sequences are often represented by phylogenetic trees Phylogenetics is.
Table 8.3 & Alberts Fig.1.38 EVOLUTION OF GENOMES C-value paradox: - in certain cases, lack of correlation between morphological complexity and genome.
Copyright © 2010 Pearson Education, Inc. publishing as Benjamin Cummings Lectures by Greg Podgorski, Utah State University Current Issues in Biology, Volume.
Testing the Neutral Mutation Hypothesis The neutral theory predicts that polymorphism within species is correlated positively with fixed differences between.
Evolutionary Genome Biology Gabor T. Marth, D.Sc. Department of Biology, Boston College
Single Nucleotide Polymorphisms (SNPs) By Amira Jhelum Rahul Shweta.
Human Mitochondrial Molecular Biology Center for Advanced Studies at Wheeler High School Post-AP DNA/Genetics.
All rights Reserved Cengage/NGL/South-Western © 2016.
W 7/30 exam #3 (bring cheat sheet) bonus #2 due W 8/6 optional final exam, during class time.
Out-of-Africa Theory: The Origin Of Modern Humans.
Lecture 24: Human Origins and Signatures of Selection April 11, 2014.
international.html Applications of Molecular Biology in Archaeology - Extraction of Ancient DNA Bradwell, S.
More molecular phylogenetics applications
Human Cells Human genomics
Biological Classification: The science of taxonomy
Hominid Evolution: On The Origin of Humans.
The Predecessors Within
Unit Genomic sequencing
Presentation transcript:

Archaeology/paleontology (“ancient DNA” analysis) Conservation biology Forensic science Taxonomy Power & pitfalls of PCR (polymerase chain reaction) Rapid amplification of specific genomic regions using very small amounts of DNA But … damaged DNA may lead to sequence artifacts or “ancient” DNA may be contaminated with “modern” DNA APPLICATIONS OF MOLECULAR PHYLOGENETICS

Forms of DNA damage likely to affect ancient DNA 8 clones of PCR-amplified mtDNA from 26,000 year old cave-bear bone C/G to T/A changes due to deamination of C residues? Hofreiter, Nat.Rev.Genet. 2:353, 2001 “ … to consider amplification of DNA molecules older than one million years of age is overly optimistic.” (Svante Paabo lab) “Note that direct sequencing would lead to ambiguous results at least at two positions (arrows)” “Assuming neutral pH, 15 o C … take about 100,000 years for hydrolytic damage to destroy all DNA…. Some environmental conditions could extend this time limit…”

Marchant Nature 472: 404, malaria parasite (Plasmodium) identified as possible cause of death - used 3,300 year-old DNA (bone) from King Tutankhamun’s tomb to construct a 5-generation family tree Hawass J. Amer.Med.Assoc. 303:638, 2010 Stoneking Nature Rev Genet 12:603, 2011 Comparison of 3 high-throughput methods of sequencing ancient DNA

“For the first time, the sequence of a near-complete nuclear genome has been obtained from the tissue of an ancient human. It comes from permafrost-preserved hair, about 4,000 years old, of a male palaeo-Eskimo of the Saqqaq culture, the earliest known settlers in Greenland.” Analysis of DNA from an ancient human - Nature Feb. 11, 2010 “We identified 353,151 high-confidence single- nucleotide polymorphisms (SNPs), of which 6.8% have not been reported previously.” Rasmussen et al. Nature 463:757, 2010

Since some SNPs are reliable markers for known phenotypes of individual humans could predict that Saqqaq man had brown eyes, non-white skin, thick dark hair, dry ear wax and increased susceptibility to baldness Lambert Nature 463:757, 2010

Comparison of Saqqaq high-confidence SNPs to those of contemporary human populations - support for migration from Siberia into New World ~ 5,500 years ago, independent of that giving rise to modern Native Americans and Inuit. Rasmussen et al. Nature 463:757, 2010 “Principal component analysis to capture genetic variation”

Hartl & Jones Fig Dispersal of modern human populations “Out-of-Africa mitochondrial Eve” hypothesis... Y chromosome data are also in agreement Stoneking Nature Rev Genet 12:603, 2011

Are Neanderthals the direct ancestors of modern Europeans? First modern humans appeared ~ 200,000 years ago First known Neanderthals ~ 300,000 years ago Neanderthal skeleton found in Germany (~ 30,000 – 100,000 years old) 1997 – S. Paabo – PCR amplified & sequenced mitochondrial DNA (D-loop region, 379 bp) from skull and compared to 986 living humans ~ 3 x more differences between human-Neanderthal than human-human and no particular similarity between Neanderthal-European human Krings, Cell 90: 19, 1997

If lineages diverged ~ 600,000 years ago, … suggests that Neanderthals were evolutionary dead-end (ie. branch that became extinct without any direct genetic contribution to modern human lineage) Science 277: 176, 1997 Coalescence times – joining of genetic lineages to common ancestor when traced back in time

2000 – mtDNA of Neanderthals from Croatia & the Caucasus analyzed Hofreiter, Nat.Rev.Genet. 2:353, 2001

“A reanalysis of the ancient mitochondrial DNA”... Gutierrez, Mol Biol Evol 19: 1359, 2002 High variation in substitution rate within D-loop region - different outcome with HVI vs. HVI + HVII sequences HVI part of D-loop HVI + HVII Previous sequence data

Figure 5.28 Chimpanzee outgroup too distant? “long branches attract” phenomenon p.214

Science 314: 1071, 2006 Sequence analysis of Neanderthal genome (Nov. 2006)

Stedman Nature 428:415, 2004

MYH16 (member of myosin multi-gene family) Stedman Nature 428:415, 2004

Compared rates of non-synonymous vs. synonymous nt substitution to assess degree of functional constraint Stedman Nature 428:415, 2004