Gene Regulation Xiaodong Wang Erich Schwarz WormBase at Caltech 2008 Advisory Board Meeting.

Slides:

Advertisements

Similar presentations

Exploiting transcription factor binding site clustering to identify cis-regulatory modules involved in pattern formation in the Drosophila genome ECS289A.

Advertisements

Creating NCBI The late Senator Claude Pepper recognized the importance of computerized information processing methods for the conduct of biomedical research.

ABSTRACT WormBase is a freely available information resource primarily for the nematode Caenorhabditis elegans but which progressively includes data from.

Combined analysis of ChIP- chip data and sequence data Harbison et al. CS 466 Saurabh Sinha.

The design, construction and use of software tools to generate, store, annotate, access and analyse data and information relating to Molecular Biology.

9 Genomics and Beyond Brief Chapter Outline

Promoter Panel Review. Background related Promoter In genetics, a promoter is a DNA sequence that enables a gene to be transcribed. It may be very long.

Identification of a Novel cis-Regulatory Element Involved in the Heat Shock Response in Caenorhabditis elegans Using Microarray Gene Expression and Computational.

PAZAR DATABASE CHIP-SEQ DEPOSIT Wyeth Wasserman.

Reconstructing Transcription Network in S.cerevisiae WANG Chao Oct. 4, 2004.

TRANSFAC Project Roadmap Discussion.  Structure DNA-binding domain (DBD)  The portion (domain) of the transcription factor that binds DNA Trans-activating.

Tutorial 5 Motif discovery.

Bio277 Lab 3: Finding Transcription Factor Binding Motifs Adapted from a Lab Written by Prof Terry Speed Jess Mar Department of Biostatistics Quackenbush.

Introduction to Bioinformatics - Tutorial no. 5 MEME – Discovering motifs in sequences MAST – Searching for motifs in databanks TRANSFAC – The Transcription.

Multiple sequence alignments and motif discovery Tutorial 5.

Exploring Protein Sequences Tutorial 5. Exploring Protein Sequences Multiple alignment –ClustalW Motif discovery –MEME –Jaspar.

Detecting binding sites for transcription factors by correlating sequence data with expression. Erik Aurell Adam Ameur Jakub Orzechowski Westholm in collaboration.

Computational Approaches for Understanding Biological Significance of Microarray Data Liangjiang (LJ) Wang KSU Bioinformatics Center, Biology.

WormBase Workshop: 2015 International C. elegans Meeting Tools & Resources InterMine / WormMine – Chris Grove JBrowse – Scott Cain The WormBase Ontology.

Promoter Analysis TFBS Detection Daniel Rico, PhD. Daniel Rico, PhD.

Motif finding : Lecture 2 CS 498 CXZ. Recap Problem 1: Given a motif, finding its instances Problem 2: Finding motif ab initio. –Paradigm: look for over-represented.

Counting position weight matrices in a sequence & an application to discriminative motif finding Saurabh Sinha Computer Science University of Illinois,

Motif finding: Lecture 1 CS 498 CXZ. From DNA to Protein: In words 1.DNA = nucleotide sequence Alphabet size = 4 (A,C,G,T) 2.DNA  mRNA (single stranded)

Searching for TFBSs with TRANSFAC - Hot topics in Bioinformatics.

Using The Gene Ontology: Gene Product Annotation.

Detecting binding sites for transcription factors by correlating sequence data with expression. Erik Aurell Adam Ameur Jakub Orzechowski Westholm in collaboration.

Gary Stormo by Andrew Bardee. History Born 1950 in South Dakota Undergraduate in Biology from Caltech PhD in Molecular Biology from University of Colorado.

Copyright OpenHelix. No use or reproduction without express written consent 2 Overview of Genome Browsers Materials prepared by Warren C. Lathe, Ph.D.

* only 17% of SNPs implicated in freshwater adaptation map to coding sequences Many, many mapping studies find prevalent noncoding QTLs.

Finish up array applications Move on to proteomics Protein microarrays.

Copyright OpenHelix. No use or reproduction without express written consent1.

Improving Curation Efficiency: User Contributions and Textpresso-Based Semi-Automation SAB 2008 WormBase Literature Curators Textpresso.

Unraveling condition specific gene transcriptional regulatory networks in Saccharomyces cerevisiae Speaker: Chunhui Cai.

CS5263 Bioinformatics Lecture 20 Practical issues in motif finding Final project.

PreDetector : Prokaryotic Regulatory Element Detector Samuel Hiard 1, Sébastien Rigali 2, Séverine Colson 2, Raphaël Marée 1 and Louis Wehenkel 1 1 Department.

Comparative genomics analysis of NtcA regulons in cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis Wen-Ting Huang.

Web Databases for Drosophila Introduction to FlyBase and Ensembl Database Wilson Leung6/06.

Gramene Objectives Provide researchers working on grasses and plants in general with a bird’s eye view of the grass genomes and their organization. Work.

Introduction to the GO: a user’s guide Iowa State Workshop 11 June 2009.

Computational Genomics and Proteomics Lecture 8 Motif Discovery C E N T R F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U E.

Localising regulatory elements using statistical analysis and shortest unique substrings of DNA Nora Pierstorff 1, Rodrigo Nunes de Fonseca 2, Thomas Wiehe.

Comparative Genomics Gene Regulatory Networks (GRNs) Anil Jegga Biomedical Informatics Contact Information: Anil Jegga Biomedical Informatics Room # 232,

Building WormBase database(s). SAB 2008 Wellcome Trust Sanger Insitute Cold Spring Harbor Laboratory California Institute of Technology ● RNAi ● Microarray.

Motif discovery and Protein Databases Tutorial 5.

Curation Tools Gary Williams Sanger Institute. SAB 2008 Gene curation – prediction software Gene prediction software is good, but not perfect. Out of.

数据库使用杨建华 2010/9/28. Outline of the Topics UCSC and Ensembl Genome Browser (Blat vs Blast vs Blastz vs Multiz) 挖掘数据用 Table Browser 或 BioMart 用户友好化你的数据.

MEME homework: probability of finding GAGTCA at a given position in the yeast genome, based on a background model of A = 0.3, T = 0.3, G = 0.2, C = 0.2.

Central dogma: the story of life RNA DNA Protein.

Detecting binding sites for transcription factors by correlating sequence data with expression. Erik Aurell Adam Ameur Jakub Orzechowski Westholm in collaboration.

How do we represent the position specific preference ? BID_MOUSE I A R H L A Q I G D E M BAD_MOUSE Y G R E L R R M S D E F BAK_MOUSE V G R Q L A L I G.

A Comparative Mapping Resource for Grains Gramene Navigation Tutorial Gramene v.19.1.

Copyright OpenHelix. No use or reproduction without express written consent1.

Inference with Gene Expression and Sequence Data BMI/CS 776 Mark Craven April 2002.

Special Topics in Genomics Motif Analysis. Sequence motif – a pattern of nucleotide or amino acid sequences GTATGTACTTACTATGGGTGGTCAACAAATCTATGTATGA TAACATGTGACTCCTATAACCTCTTTGGGTGGTACATGAA.

Computational Biology, Part 3 Representing and Finding Sequence Features using Frequency Matrices Robert F. Murphy Copyright  All rights reserved.

Intro to Probabilistic Models PSSMs Computational Genomics, Lecture 6b Partially based on slides by Metsada Pasmanik-Chor.

Introduction to Bioinformatics - Tutorial no. 5 MEME – Discovering motifs in sequences MAST – Searching for motifs in databanks TRANSFAC – the Transcription.

Sequence Curation Paul Davis Sanger Institute. Overview Sequence curation within WormBase consortium. Import of sequence data. Prediction stats. Work.

For this demo you already need the XtAtoh7.maf multiple alignment file from demo (a). Another example.maf file is also available on the ConTra help page.

The Biologist’s Wishlist A complete and accurate set of all genes and their genomic positions A set of all the transcripts produced by each gene The location.

BIOBASE Training TRANSFAC ® Containing data on eukaryotic transcription factors, their experimentally-proven binding sites, and regulated genes ExPlain™

bacteria and eukaryotes

Babak Alipanahi1, Andrew Delong, Matthew T Weirauch & Brendan J Frey

University of Pittsburgh

Annotation: linking literature to gene products

Working in the Post-Genomic C. elegans World

Genetic Data in Mary Ann Tuli.

Nora Pierstorff Dept. of Genetics University of Cologne

BIOBASE Training TRANSFAC® ExPlain™

Presentation transcript:

Gene Regulation Xiaodong Wang Erich Schwarz WormBase at Caltech 2008 Advisory Board Meeting

SAB 2008 Gene_Regulation curation § Trans_regulation § gene A regulates gene B at expression level § Yeast two-hybrid data § Cis_regulation § Sequence features § PFMs and PWMs

SAB 2008 GR shown on the website Feature : WBsf Sequence T07C4 DNA_text "gtaacgctgctcc” Flanking_sequences T07C4 "ctcccgaatgtcatccacaaaccccgactc”"gaaacagattttcactgcctgggggcatca” Associated_with_gene WBGene Paper_evidenceWBPaper Associated_with_operon CEOP3666 Paper_evidence WBPaper Associated_with_gene_regulation WBPaper _ced-9 Paper_evidenceWBPaper Associated_with_expression_pattern Expr4230 Paper_evidence WBPaper Species "Caenorhabditis elegans” Defined_by_paper WBPaper Bound_by_product_of WBGene Bound_by_product_of WBGene Method binding_site

SAB 2008 Curation Progress WS170WS190 GR objects Y1H objects0428

SAB 2008 PFM/PWM curation Introduction Position Frequency Matrices (PFMs) and Position Weight Matrices (PWMs) are used to generalize sets of known binding sites PFMs/PWMs can be used for genome-wide searches of binding sites Experimentally well-validated DNA-binding profiles and individual binding sites from transcription factors are available in ~300 C.elegans publications Lack of tools that will allow biologists to create matrix-based motifs from lists of known sites

SAB 2008 PFM/PWM curation Nature Reviews Genetics 5, (April 2004) Steps of building a model Data collection Position frequency matrix (PFM) Position weight matrix (PWM) Sequence logo

SAB 2008 PFM/PWM curation ?Position_Matrix Description ?Text #Evidence Type UNIQUE Frequency Weight Background_model Text UNIQUE Float Site_values Text UNIQUE Float REPEAT Threshold Float Associated_feature ?Feature XREF Associated_with_Position_Matrix #Evidence Remark ?Text #Evidence ?Feature Associations Associated_with_Position_Matrix ?Position_Matrix XREF Associated_feature #Evidence New Position_Matrix model

SAB 2008 PFM/PWM curation PFM form WBPaper: Position_Matrix : "WBPmat " // DAF-16.pfm Description "DAF-16 binding sites; frequency matrix." Paper_evidence"WBPaper " Type Frequency Site_values A Site_values C Site_values G Site_values T PWM conversion using TBFS software ( Position_Matrix : "WBPmat ” //DAF-16.pwm Description "DAF-16 binding sites; weight matrix, derived by TFBS::Matrix::PFM from frequency matrix WBPmat " Paper_evidence "WBPaper " Type Weight Site_values A Site_values C Site_values G Site_values T Position_Matrix objects

SAB 2008 PFM/PWM curation How biologists could use our data Use Genome Browser with existing software for mapping restriction sites on-the-fly Scan pre-computed genomic instances/sites of PFMs/PWMs Available online software: CisOrtho, JASPAR, CONSITE, etc.

SAB 2008 PFM/PWM curation Our plan for curation Annotate ~200 sites from ~300 papers Make data available online in WormBase Map and link PFMs/PWMs to the genome Provide search tool for matches to PFMs/PWMs