454 Genome Sequence Assembly and Analysis HC70AL S09 04-13-09 Brandon Le & Min Chen.

Slides:

Advertisements

Similar presentations

Genome Projects A genome project is the complete DNA sequence of the genome of an organism, and the identification of all its genes Genome projects are.

Advertisements

Suppl. Fig. 1 d) LG-RCA-b1-re) L2-RCA-A3-r c) betasatellite f) 9S1-RCA-a6-r a) DNA-Ab) alphasatellite Fig. 7. Genome maps of unusual or novel circular.

Annotating a Scarlet Runner Bean genome fragment put together by shotgun sequencing Scarlet Runner ean Max Bachour.

Max BachourJessica Chen. Shotgun or 454 sequencing High throughput sequencing technique that can collect a large amount of data at a fast rate. Works.

SEQUENCING-related topics 1. chain-termination sequencing 2. the polymerase chain reaction (PCR) 3. cycle sequencing 4. large scale sequencing stefanie.hartmann.

Bioinformatics caacaagccaaaactcgtacaaCgagatatctcttggaaaaactgctcacaatattgacgtacaaggttgttcatgaaactttcggtaAcaatcgttgacattgcgacctaatacagcccagcaagcagaat Managing.

Class 02: Whole genome sequencing. The seminal papers ``Is Whole Genome Sequencing Feasible?'' ``Whole-Genome DNA.

BME 130 – Genomes Lecture 7 Genome Annotation I – Gene finding & function predictions.

Bio 465 Summary. Overview Conserved DNA Conserved DNA Drug Targets, TreeSAAP Drug Targets, TreeSAAP Next Generation Sequencing Next Generation Sequencing.

3 September, 2004 Chapter 20 Methods: Nucleic Acids.

Genome Assembly Charles Yan Fragment Assembly Given a large number of fragments, such as ACC AC AT AC AT GG …, the goal is to figure out the original.

Genome sequencing. Vocabulary Bac: Bacterial Artificial Chromosome: cloning vector for yeast Pac, cosmid, fosmid, plasmid: cloning vectors for E. coli.

Genome Assembly Bonnie Hurwitz Graduate student TMPL.

Sequencing a genome (a) outline the steps involved in sequencing the genome of an organism; (b) outline how gene sequencing allows for genome-wide comparisons.

DNA Sequencing. Fig

Chapter 6 Gene Prediction: Finding Genes in the Human Genome.

Lecture 15 – Gene Cloning Based on Chapter 08 - Genomics: The Mapping and Sequencing of Genomes Copyright © 2010 Pearson Education Inc.

Presentation on genome sequencing. Genome: the complete set of gene of an organism Genome annotation: the process by which the genes, control sequences.

Fig Chapter 12: Genomics. Genomics: the study of whole-genome structure, organization, and function Structural genomics: the physical genome; whole.

Genome sequencing Haixu Tang School of Informatics.

Genome Sequencing in the Legumes Le et al Phylogeny Major sequencing efforts Minor sequencing efforts ~14 MY ~45 MY.

Steps in a genome sequencing project Funding and sequencing strategy source of funding identified / community drive development of sequencing strategy.

Common Errors in Student Annotation Submissions contributions from Paul Lee, David Xiong, Thomas Quisenberry Annotating multiple genes at the same locus.

SIZE SELECT SHEAR Shotgun DNA Sequencing (Technology) DNA target sample LIGATE & CLONE Vector End Reads (Mates) SEQUENCE Primer.

Genome annotation and search for homologs. Genome of the week Discuss the diversity and features of selected microbial genomes. Link to the paper describing.

.1Sources of DNA and Sequencing Methods.1Sources of DNA and Sequencing Methods 2 Genome Assembly Strategy and Characterization 2 Genome Assembly.

Short read alignment BNFO 601. Short read alignment Input: –Reads: short DNA sequences (upto a few hundred base pairs (bp)) produced by a sequencing machine.

Mojavensis: Issues of Polymorphisms Chris Shaffer GEP 2009 Washington University.

SRB Genome Assembly and Analysis From 454 Sequences HC70AL S Brandon Le & Min Chen.

Repetitive element (RE) mediated DNA level recombination by non-allelic homologous recombination (NAHR) as the mechanism for disperse duplication of a.

DNA Replication. Genes as Information Transfer A gene is the sequence of nucleotides within a portion of DNA that codes for a peptide or a functional.

Chapter 5 Sequence Assembly: Assembling the Human Genome.

CISC667, S07, Lec4, Liao CISC 667 Intro to Bioinformatics (Spring 2007) Whole genome sequencing Mapping & Assembly.

nome/program.html.

Notes: Human Genome (Right side page)

MICROBIOLOGIA GENERALE Prokaryotic genomes. The prokaryotic genome.

REVIEW OF MOLECULAR GENETICS DR. EDELBERG. Genes, DNA, & Chromosomes.

Genome sequencing and annotation Week 2 reading assignment - pages 63-78, 93-98, Boxes 2.1 and don’t worry about details of similarity scoring.

Topic Cloning and analyzing oxalate degrading enzymes to see if they dissolve kidney stones with Dr. VanWert.

Gene prediction in metagenomic fragments: A large scale machine learning approach Katharina J Hoff, Maike Tech, Thomas Lingner, Rolf Daniel, Burkhard Morgenstern.

MICROBIOLOGIA GENERALE Prokaryotic genomes. The Escherichia coli nucleoid.

Genetic Code and Interrupted Gene Chapter 4. Genetic Code and Interrupted Gene Aala A. Abulfaraj.

Naotoshi Seo, Hiroshi Toyoizumi Performance Evaluation Laboratory

Genomics Sequencing genomes.

Schematic drawing of the human X chromosome and physical map the Xp interval carrying the ND gene. A 640-kb yeast artificial chromosome (YAC) clone was.

A Fast Hybrid Short Read Fragment Assembly Algorithm

اجابة السؤال الاول.

Pre-genomic era: finding your own clones

Human Molecular Genetics

RFLP “Restriction Fragment Length Polymorphism” Basic idea: Uses:

CS 598AGB Genome Assembly Tandy Warnow.

Bioinformatics: Buzzword or Discipline (???)

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

A User’s Guide to GO: Structural and Functional Annotation

Lecture 9 Genome Mapping By Ms. Shumaila Azam

Chapter 24 Genomics and DNA Sequencing

C. Héritier, L. Poirel, P. Nordmann

CSCI 1810 Computational Molecular Biology 2018

Reading Frames and ORF’s

Assembly of the novel bat gammaherpesvirus genome highlights ORFs related to EHV-2 and accessory ORFs related to other gammaherpesviruses. Assembly of.

Assembly of Solexa tomato reads

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Long Orf Added Long Orf Gene +2 frame 52,913-54,454

.1Sources of DNA and Sequencing Methods 2 Genome Assembly Strategy and Characterization 3 Gene Prediction and Annotation 4 Genome Structure 5 Genome.

Common Errors in Student Annotation Submissions contributions from Paul Lee, David Xiong, Thomas Quisenberry Annotating multiple genes at the same locus.

Genome resolved metagenomics

Comparison of species and function profiles with ultradeep sequencing data. Comparison of species and function profiles with ultradeep sequencing data.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

General overview of the bioinformatic pipelines for the 16S rRNA gene microbial profiling and shotgun metagenomics. General overview of the bioinformatic.

THE HUMAN GENOME PROJECT. Gene Myers Let’s sequence the human genome with the shotgun strategy That is impossible, and a bad idea anyway Phil Green 1997.

Presentation transcript:

454 Genome Sequence Assembly and Analysis HC70AL S Brandon Le & Min Chen

Shotgun Genome Sequencing original DNA 454 Sequencing Sequence Analysis Begins!!! fragmented DNA REPEAT 1

Genome Sequence Analysis - Step One Assemble Sequences into Contigs Sequenced fragmented DNA AAACGCGATCGATCGATCGA AAACGCGATCGATCGATCGATCGATCGATCGAT CGTAG CGATCGATCGATCGATCGTAG AAACGCGATCGATCGATCGA Assembled DNA Sequence CONTIG 1CONTIG 2CONTIG 3

Genome Sequence Analysis - Step One Initial Problem with Assembly Sequenced fragmented DNA Incorrectly Assembled DNA Sequence CONTIG 1 CONTIG 2

Genome Sequence Analysis - Step One Need to Mask Repeats Sequenced fragmented DNA Masked DNA Sequence CONTIG 1 CONTIG 3 CONTIG 5 CONTIG 2 CONTIG 4 Assembled DNA Sequence

Genome Sequence Analysis - Step Two Determine Open Reading Frame CONTIG 1 CONTIG 3 CONTIG 5 CONTIG 2 CONTIG 4 Assembled DNA Sequence GENE 1 GENE 2 Identify ORF