Copyright OpenHelix. No use or reproduction without express written consent1.

Slides:



Advertisements
Similar presentations
COMPANY LOGO HERE Getting Started 1. Download the setup file: Go to Click on the Visit Setup Page link (includes Java.
Advertisements

Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent 2 Overview of Genome Browsers Materials prepared by Warren C. Lathe, Ph.D.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
An Introduction to Designing and Executing Workflows with Taverna Aleksandra Pawlik materials by: Katy Wolstencroft University of Manchester.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Comparative Genomics Gene Regulatory Networks (GRNs) Anil Jegga Biomedical Informatics Contact Information: Anil Jegga Biomedical Informatics Room # 232,
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
The UCSC Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña CNIO Bioinformatics.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Regulatory Genomics Lab Saurabh Sinha Regulatory Genomics | Saurabh Sinha | PowerPoint by Casey Hanson.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
GVS: Genome Variation Server Materials prepared by: Warren C. Lathe, PhD Updated: Q Version 2.
Copyright OpenHelix. No use or reproduction without express written consent1.
Tools in Bioinformatics Genome Browsers. Retrieving genomic information Previous lesson(s): annotation-based perspective of search/data Today: genomic-based.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1 1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Introduction to RNA-Seq & Transcriptome Analysis
Presentation transcript:

Copyright OpenHelix. No use or reproduction without express written consent1

Materials prepared by: Sawsan Khuri, Ph.D. Updated: Q Version 2.0 MEME Motif Discovery and Search Algorithm

Copyright OpenHelix. No use or reproduction without express written consent3 MEME Agenda Introduction and Credits Basic Searches Understanding the Results Summary Exercises MEME:

Copyright OpenHelix. No use or reproduction without express written consent4 Introduction For detection of conserved motifs in DNA or protein sequences

Copyright OpenHelix. No use or reproduction without express written consent5 MEME algorithm part of MEME Suite Motif-based sequence analysis tools Introductory tutorials available on: MEME Suite Overview MEME Algorithm GLAM2 Algorithm FIMO, MAST & GLAM2SCAN TOMTOM & GOMO Focus here

Copyright OpenHelix. No use or reproduction without express written consent6 Credits Contact, Documentation, FAQs, User Support & more

Copyright OpenHelix. No use or reproduction without express written consent7 MEME – Where to Start Expand menu for more options Submit A Job Documentation Downloads User Support

Copyright OpenHelix. No use or reproduction without express written consent8 MEME Agenda  Introduction and Credits  Basic Searches  Understanding the Results  Summary  Exercises MEME:

Copyright OpenHelix. No use or reproduction without express written consent9 Input Sequences FASTA FORMAT: >GENE_1_ID and a few words accgtgggatggacgctgagctgacca aagctagatcgaatatagactagcatg atcggataga >GENE_2_ID and a few words atatagcagtcgggatggacgctgagc tgatagatcgatgctagtcgatagctg atgcta >GENE_3_ID and a few words atcgatggtgctgataacacgatgctg acgatgctagatcgatcgagcatggga tggacgctgagctgacatccgact ¶ ¶ Remember to save as a plain text file

Copyright OpenHelix. No use or reproduction without express written consent10 Required Parameters Motif occurrence Motif width Number of motifs

Copyright OpenHelix. No use or reproduction without express written consent11 Optional Parameters Description # of sites Provide ‘negative sequences’ for discriminative discovery Strand, palindromes

Copyright OpenHelix. No use or reproduction without express written consent12 Browser Result Display Job Running Result Display Dataset Stats Results Outputs

Copyright OpenHelix. No use or reproduction without express written consent13 MEME Agenda  Introduction and Credits  Basic Searches  Understanding the Results  Summary  Exercises MEME:

Copyright OpenHelix. No use or reproduction without express written consent14 Result Display Confirmation MEME Sequences submitted

Copyright OpenHelix. No use or reproduction without express written consent15 MEME Results Page, Top Result Summary

Copyright OpenHelix. No use or reproduction without express written consent16 Understanding the Results – Motif 1, upper Download Motif

Copyright OpenHelix. No use or reproduction without express written consent17 Position of Motif 1 Motif location on sequences Additional motif reports

Copyright OpenHelix. No use or reproduction without express written consent18 Motifs Summary Diagram Summary Diagram: Location of motifs found on all input sequences

Copyright OpenHelix. No use or reproduction without express written consent19 Explanations Search parameters Explanation of results scroll

Copyright OpenHelix. No use or reproduction without express written consent20 MEME Agenda  Introduction and Credits  Basic Searches  Understanding the Results  Summary  Exercises MEME:

Copyright OpenHelix. No use or reproduction without express written consent21 Motif 1 results Summary results Summary

Copyright OpenHelix. No use or reproduction without express written consent22 MEME Agenda  Introduction and Credits  Basic Searches  Understanding the Results  Summary  Exercises MEME:

Copyright OpenHelix. No use or reproduction without express written consent23