Copyright OpenHelix. No use or reproduction without express written consent1
Materials prepared by: Sawsan Khuri, Ph.D. Updated: Q Version 2.0 MEME Motif Discovery and Search Algorithm
Copyright OpenHelix. No use or reproduction without express written consent3 MEME Agenda Introduction and Credits Basic Searches Understanding the Results Summary Exercises MEME:
Copyright OpenHelix. No use or reproduction without express written consent4 Introduction For detection of conserved motifs in DNA or protein sequences
Copyright OpenHelix. No use or reproduction without express written consent5 MEME algorithm part of MEME Suite Motif-based sequence analysis tools Introductory tutorials available on: MEME Suite Overview MEME Algorithm GLAM2 Algorithm FIMO, MAST & GLAM2SCAN TOMTOM & GOMO Focus here
Copyright OpenHelix. No use or reproduction without express written consent6 Credits Contact, Documentation, FAQs, User Support & more
Copyright OpenHelix. No use or reproduction without express written consent7 MEME – Where to Start Expand menu for more options Submit A Job Documentation Downloads User Support
Copyright OpenHelix. No use or reproduction without express written consent8 MEME Agenda Introduction and Credits Basic Searches Understanding the Results Summary Exercises MEME:
Copyright OpenHelix. No use or reproduction without express written consent9 Input Sequences FASTA FORMAT: >GENE_1_ID and a few words accgtgggatggacgctgagctgacca aagctagatcgaatatagactagcatg atcggataga >GENE_2_ID and a few words atatagcagtcgggatggacgctgagc tgatagatcgatgctagtcgatagctg atgcta >GENE_3_ID and a few words atcgatggtgctgataacacgatgctg acgatgctagatcgatcgagcatggga tggacgctgagctgacatccgact ¶ ¶ Remember to save as a plain text file
Copyright OpenHelix. No use or reproduction without express written consent10 Required Parameters Motif occurrence Motif width Number of motifs
Copyright OpenHelix. No use or reproduction without express written consent11 Optional Parameters Description # of sites Provide ‘negative sequences’ for discriminative discovery Strand, palindromes
Copyright OpenHelix. No use or reproduction without express written consent12 Browser Result Display Job Running Result Display Dataset Stats Results Outputs
Copyright OpenHelix. No use or reproduction without express written consent13 MEME Agenda Introduction and Credits Basic Searches Understanding the Results Summary Exercises MEME:
Copyright OpenHelix. No use or reproduction without express written consent14 Result Display Confirmation MEME Sequences submitted
Copyright OpenHelix. No use or reproduction without express written consent15 MEME Results Page, Top Result Summary
Copyright OpenHelix. No use or reproduction without express written consent16 Understanding the Results – Motif 1, upper Download Motif
Copyright OpenHelix. No use or reproduction without express written consent17 Position of Motif 1 Motif location on sequences Additional motif reports
Copyright OpenHelix. No use or reproduction without express written consent18 Motifs Summary Diagram Summary Diagram: Location of motifs found on all input sequences
Copyright OpenHelix. No use or reproduction without express written consent19 Explanations Search parameters Explanation of results scroll
Copyright OpenHelix. No use or reproduction without express written consent20 MEME Agenda Introduction and Credits Basic Searches Understanding the Results Summary Exercises MEME:
Copyright OpenHelix. No use or reproduction without express written consent21 Motif 1 results Summary results Summary
Copyright OpenHelix. No use or reproduction without express written consent22 MEME Agenda Introduction and Credits Basic Searches Understanding the Results Summary Exercises MEME:
Copyright OpenHelix. No use or reproduction without express written consent23