Polymorphisms traits GWAS 3 million/person 10K-100K people.

Slides:



Advertisements
Similar presentations
Lecture 2 Strachan and Read Chapter 13
Advertisements

LS-SNP: Large-scale annotation of coding non- synonymous SNPs based on multiple information sources -Bioinformatics April 2005.
Traits, Genes, and Alleles TERMINOLOGY FOR THE SUCCESS OF GENETICS.
CZ5225 Methods in Computational Biology Lecture 9: Pharmacogenetics and individual variation of drug response CZ5225 Methods in Computational Biology.
Genetic susceptibility: Polymorphisms of the 8q24 chromosome S. Lani Park 05/07/09.
Molecular Genetics DNA RNA Protein Phenotype Genome Gene
1 Computational Molecular Biology MPI for Molecular Genetics DNA sequence analysis Gene prediction Gene prediction methods Gene indices Mapping cDNA on.
Genomics An introduction. Aims of genomics I Establishing integrated databases – being far from merely a storage Linking genomic and expressed gene sequences.
Predicting the Function of Single Nucleotide Polymorphisms Corey Harada Advisor: Eleazar Eskin.
Introduction to Computational Biology Topics. Molecular Data Definition of data  DNA/RNA  Protein  Expression Basics of programming in Matlab  Vectors.
Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer AAGTCGGTGATGATTGGGACTGCTCT[C/T]AACACAAGCGAGATGAAGAAACTGA Jacob Biesinger Dr.
Something related to genetics? Dr. Lars Eijssen. Bioinformatics to understand studies in genomics – São Paulo – June Image:
PolyPhen and SIFT: Tools for predicting functional effects of SNPs Epi 244 Spring 2009 Sam S. Oh.
CS 374: Relating the Genetic Code to Gene Expression Sandeep Chinchali.
Chromosomes carry genetic information
Type 2 Diabetes With type 2 diabetes, your body either resists the effects of insulin — a hormone that regulates the movement of sugar into your cells.
Gene expression array and SNP array
Analysis of microarray data
Department of Biomedical Informatics Bioinformatics and Genetics Kun Huang Department of Biomedical Informatics OSUCCC Biomedical Informatics Shared Resource.
Problem Set I review BIOL221T: Advanced Bioinformatics for Biotechnology Irene Gabashvili, PhD.
Genetic Variation Influences Glutamate Concentrations in Brains of Patients with Multiple Sclerosis Robby Bonanno.
Fig Chapter 12: Genomics. Genomics: the study of whole-genome structure, organization, and function Structural genomics: the physical genome; whole.
Doug Brutlag 2011 Genomics & Medicine Doug Brutlag Professor Emeritus of Biochemistry &
Allele. Alternate form of a gene gene variant autosome.
DNA Chips Attach DNA to tiny spots on glass slides (i.e., chip). Hybridize fluorescently-labeled DNA probes to chip. Detect hybridization to different.
SNP Haplotypes as Diagnostic Markers Shrish Tiwari CCMB, Hyderabad.
SNPs and the Human Genome Prof. Sorin Istrail. A SNP is a position in a genome at which two or more different bases occur in the population, each with.
GWAS Hits and Functional Implications Peter Castaldi February 1, 2013.
Korea BioInformation Center Byoung-Chul Kim
Supplemental Figure 1A. A small fraction of genes were mapped to >=20 SNPs. Supplemental Figure 1B. The density of distance from the position of an associated.
GENE EXPRESSION TRANSCRIPTION, TRANSLATION AND MUTATIONS.
DNA / RNA. tRNA rRNA mRNA 5’ 3’ Types of RNA Transcription: transfer of information from DNA to RNA in the nucleus  In the process of transcription.
Gene expression. The information encoded in a gene is converted into a protein  The genetic information is made available to the cell Phases of gene.
Lecture 6. Functional Genomics: DNA microarrays and re-sequencing individual genomes by hybridization.
MEME homework: probability of finding GAGTCA at a given position in the yeast genome, based on a background model of A = 0.3, T = 0.3, G = 0.2, C = 0.2.
The Co-Evolution of Genetics and Statistics Bio-Stat seminar 2 February 2011.
Heredity  The study of the passing on of traits from parents to kids.  Learn how and why physical and behavioral characteristics are passed on to from.
The Future of Genetics Research Lesson 7. Human Genome Project 13 year project to sequence human genome and other species (fruit fly, mice yeast, nematodes,
 Genetics Primer: SBI 4UI Mrs. Tuma. Test Your Genetic IQ: 1. The Human Genome contains 3 billion base pairs. True or False?
Transcriptome What is it - genome wide transcript abundance How do you obtain it - Arrays + MPSS What do you do with it when you have it - ?
Linkage. Announcements Problem set 1 is available for download. Due April 14. class videos are available from a link on the schedule web page, and at.
Analyzing DNA using Microarray and Next Generation Sequencing (1) Background SNP Array Basic design Applications: CNV, LOH, GWAS Deep sequencing Alignment.
Chapter 11 Review. Explain the difference between each of the following 1. Operator, promoter -Operator: DNA segment where an inhibitor protein binds.
Genetics of Gene Expression BIOS Statistics for Systems Biology Spring 2008.
Notes: Human Genome (Right side page)
Using public resources to understand associations Dr Luke Jostins Wellcome Trust Advanced Courses; Genomic Epidemiology in Africa, 21 st – 26 th June 2015.
EQTLs.
The trait defines the two major germplasm groups in barley
Part 5 Translation.
CSE 182 Project.
CANDIDATE GENE STUDIES AND GWAS SUGGEST SUBSTANTIAL GENETIC INFLUENCE ON DEFICITS IN OLFACTORY IDENTIFICATION AMONG PERSONS AT RISK OF AD  Marie-Elyse.
Figure 1. Exploring and comparing context-dependent mutational profiles in various cancer types. (A) Mutational profiles of pan-cancer somatic mutations,
Integromic Analysis of Genetic Variation and Gene Expression Identifies Networks for Cardiovascular Disease PhenotypesCLINICAL PERSPECTIVE by Chen Yao,
Pick a Gene Assignment 4 Requirements
Genetics Definitions Definition Key Word
Genetic Variations with Populations
Polymorphisms GWAS traits.
By Michael Fraczek and Caden Boyer
Lipopolysaccharide binding protein promoter variants influence the risk for Gram-negative bacteremia and mortality after allogeneic hematopoietic cell.
MUTATIONS.
Polymorphisms GWAS traits.
Nova2 Interacts with a Cis-Acting Polymorphism to Influence the Proportions of Drug- Responsive Splice Variants of SCN1A  Erin L. Heinzen, Woohyun Yoon,
Integrative Multi-omic Analysis of Human Platelet eQTLs Reveals Alternative Start Site in Mitofusin 2  Lukas M. Simon, Edward S. Chen, Leonard C. Edelstein,
Personalized Medicine: Patient-Predictive Panel Power
Intro to Genetics.
Genetics of Human Cardiovascular Disease
Figure 2 LocusZoom plots
sac mutants are hypersensitive to IR
The principles of genetic association
Presentation transcript:

polymorphisms traits GWAS 3 million/person 10K-100K people

polymorphisms genes Functional mutations ~18 million in dbSNP HMG CoA reduct. LPA Protein changes expression changes Pathways Cholesterol levels Traits Cardiovascular disease

polymorphisms Traits Functional mutations 113 SNPs in actn3 Power muscle 1 SNP is stop codon

MMP20 Functional mutations AGAG Expression SNP TCTC TCTC Coding SNPs

Total Expression Analysis p=1.2x n=153

G A Look at expression in : G/G High G/A Medium A/A Low

Allele-specific Expression Make cDNA Method 1: sequence cDNAs and count if C allele is more abundant than the G allele. Method 2: use DNA arrays and see if the C oligo is more intense than the G oligo.

* * Allele-specific Expression Expressed in the same nucleus Same genetic background Same environment Extremely sensitive

Nature Genetics 41, 885, 2009 rs is a G/T SNP in a TCF4 binding site near the myc oncogene G/T myc

Nature Genetics 41, 885, 2009 The G allele shows stronger binding to TCF4 than the T allele G/T myc

polymorphisms genes Functional mutations ~18 million in dbSNP All genes expressed in cardiovasculature Genes that change expression in CVD Protein changes expression changes Pathways Cholesterol levels Traits Cardiovascular disease

PLoS Genet 5 (2009): e doi: /journal.pgen

Kidney as a model for human aging Filtration rate declines with age Easy to test function Medulla Cortex Renal Pelvis

Genomic Convergence

Each row is a gene Yellow is high level expression Blue is low level expression 447 age-regulated genes in the human kidney Each column corresponds to a person, youngest to oldest left: Cortex right: medulla

* * Differential expression from different alleles

Allele-Specific Expression Red lines indicate 95% confidence intervals Example shows 11/12 heterozygotes have higher expression of A allele than C allele.

Genomic Convergence 630 Candidate Aging Genes 101 genes with eQTLs

polymorphisms genes Functional mutations ~18 million in dbSNP All genes expressed in cardiovasculature Genes that change expression in CVD Protein changes expression changes Pathways GO, KEGG, networks etc. Traits Cardiovascular disease