Protein Synthesis Making Proteins 2009-2010

Cell organization DNA DNA is in the nucleus genes = instructions for making proteins want to keep it there = protected in the nucleus “locked in the vault” cytoplasm nucleus

Cell organization Proteins chains of amino acids made by a “protein factory” or ribosome in cytoplasm Rough ER protein for export, free ribosome Protein for cell protein factory = ribosome cytoplasm nucleus build proteins ribosome

Passing on DNA information Need to get DNA gene information from nucleus to cytoplasm need a copy of DNA messenger RNA (mRNA) is made from DNA mRNA can leave the nucleus cytoplasm nucleus build proteins mRNA ribosome

http://www.biologyjunction.com/nucleic_acids_.htm

RNA Translation: Protein Synthesis http://www.biologyjunction.com/ANIMPROT.htm http://www.biologyjunction.com/biology%20class%20notes2.htm

From nucleus to cytoplasm transcription Ribosome DNA mRNA protein translation trait nucleus cytoplasm

DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases double stranded G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded

Transcription Making mRNA from DNA DNA strand is the template (pattern) pairing bases U : A G : C Enzyme RNA polymerase

Pairing bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Pairing bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Pairing bases of DNA & RNA Pair RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Pairing bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ribosome U C A G

cytoplasm protein nucleus ribosome U C A G trait

How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA mRNA U C A G aa

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon ribosome AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein Codon = block of 3 mRNA bases

The mRNA code For ALL life! Code has duplicates Start codon strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA mRNA AUGCGUGUAAAUGCAUGCGCC codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid Anti-codon = block of 3 tRNA bases

mRNA to protein = Translation The working instructions  mRNA The reader  ribosome The transporter  transfer RNA (tRNA) ribosome mRNA U C A G aa tRNA G U aa tRNA U A C aa tRNA G A C tRNA aa A G U

From gene to RNA to protein _____________ aa _________________ ______________ ______ __________ ______ ribosome U C A G _______ aa _____________ trait

From gene to RNA to protein aa cytoplasm transcription translation DNA mRNA protein ribosome U C A G tRNA aa trait nucleus

cytoplasm protein transcription translation nucleus trait

From gene to protein protein transcription translation