1. David Goldberg CS 1950 Directed Study

2. RNA are the building blocks for life RNA is read by ribosome's which then create a functional product.(i.e. protein that the cell needs) Similarly to lines of code, RNA is instructions on how to build the most fundamental parts of a living thing.

3. Alternative pre-mRNA splicing generates widespread transcript diversity by specifying the inclusion or exclusion of sequences encoding protein functional domains. We are interested in understanding how these mechanisms are coordinated in the nervous system to tailor the structure of protein molecules for their specific roles at the synapse relating to neuronal communication and plasticity.

4. The sequences that I will be dealing with include the possible characters: A, C, G, T Y= C or T R=A or G N=A or C or T or G

5. Up Intron Exon Down Intron CCCACTCCATGATTACACCATGCCGTAGCTCATGCC GATTACACATGCCGTAG GCCACGTCTTTTGCTCTTTGCAGGATTACATCACTGGAAACTTTAGCCACGTAAACTTTA Pattern 1:ACATCAC Pattern 2:ACGT

6. Desired Upgrades Current Program: Command line arguments only (2 patterns) Cannot Use Y or R or N Only Checks Human RNA for patterns Has static search length Result file displays Human RNA id, mouse RNA id, and last 75 characters. Only Searches Down Intron New Program: Better user interface Ability to use Y,R and N Control Lengths between patterns and length of search Easier to decipher result file Checks Human and Mouse RNA Can search up or down introns and exons.

7. Possible Problems Programming in Perl Extensive Use of Regular Expressions Trouble figuring out exactly what is needed to be done Don’t know if what we want to be done can be done