Presentation is loading. Please wait.

Presentation is loading. Please wait.

Soft Computing & Computational Intelligence Biologically inspired computing models Compatible with human expertise/reasoning Intensive numerical computations.

Published byBenedict Bond Modified over 9 years ago

Similar presentations

Presentation on theme: "Soft Computing & Computational Intelligence Biologically inspired computing models Compatible with human expertise/reasoning Intensive numerical computations."— Presentation transcript:

1 Soft Computing & Computational Intelligence Biologically inspired computing models Compatible with human expertise/reasoning Intensive numerical computations Data and goal driven Model-free learning Fault tolerant Real world/novel applications

2 Soft Computing & Computational Intelligence Artificial Neural Networks (ANN) Fuzzy Logic Genetic Algorithms (GAs) Fractals/Chaos Artificial life Wavelets Data mining ANNs FL GAs

3 Biological Neuron dendrites synapse axon hillock synapse signal flow cell body hair cell (sensory transducer) axon

4  weighted sum of the inputs output nonlinear transfer function inputs i1i1 i2i2 i3i3 w1w1 w3w3 w2w2 w1w1 i1i1 + w2w2 i2i2 +w3w3 i3i3 w1w1 i1i1 + w2w2 i2i2 +w3w3 i3i3 o o 1 sigmoid 0 Artificial Neuron

5    Molecular weight H-bonding Boiling Point Hydrofobicity Biological response Electrostatic interactions   w 11 w 34   w 23 w 11 h h Neural Network Molecular Descriptor Observable Projection There are many algorithms that can determine the weights for ANNs Neural Net Yields Weights to Map Inputs to Outputs

6 Neural Networks in a Nutshell A problem can be formulated and represented as a mapping problem from Such a map can be realized by an ANN, which is a framework of basic building blocks of McCulloch-Pitts neurons The neural net can be trained to conform with the map based on samples of the map and will reasonably generalize to new cases it has not encountered before

7 Neural Network as a Map

8 Poisonous/Edible Mushroom Classification Problem 1. cap-shape: bell=b,conical=c,convex=x,flat=f,knobbed=k,sunken=s 2. cap-surface: fibrous=f,grooves=g,scaly=y,smooth=s 3. cap-color: brown=n,buff=b,cinnamon=c,gray=g,green=r, pink=p,purple=u,red=e,white=w,yellow=y 4. bruises?: bruises=t,no=f 5. odor: almond=a,anise=l,creosote=c,fishy=y,foul=f, musty=m,none=n,pungent=p,spicy=s 6. gill-attachment: attached=a,descending=d,free=f,notched=n 7. gill-spacing: close=c,crowded=w,distant=d 8. gill-size: broad=b,narrow=n 9. gill-color: black=k,brown=n,buff=b,chocolate=h,gray=g, green=r,orange=o,pink=p,purple=u,red=e,white=w,yellow=y 10. stalk-shape: enlarging=e,tapering=t 11. stalk-root: bulbous=b,club=c,cup=u,equal=e,rhizomorphs=z,rooted=r,missing=? 12. stalk-surface-above-ring: ibrous=f,scaly=y,silky=k,smooth=s 13. stalk-surface-below-ring: ibrous=f,scaly=y,silky=k,smooth=s 14. stalk-color-above-ring: brown=n,buff=b,cinnamon=c,gray=g,orange=o,pink=p,red=e,white=w,yellow=y 15. stalk-color-below-ring: brown=n,buff=b,cinnamon=c,gray=g,orange=o, pink=p,red=e,white=w,yellow=y 16. veil-type: partial=p,universal=u 17. veil-color: brown=n,orange=o,white=w,yellow=y 18. ring-number: none=n,one=o,two=t 19. ring-type: cobwebby=c,evanescent=e,flaring=f,large=l,none=n,pendant=p,sheathing=s,zone=z 20. spore-print-color: black=k,brown=n,buff=b,chocolate=h,green=r,orange=o,purple=u,white=w,yellow=y 21. population: abundant=a,clustered=c,numerous=n,scattered=s,several=v,solitary=y 22. habitat: grasses=g,leaves=l,meadows=m,paths=p,urban=u,waste=w,woods=d Relevant Information: This data set includes descriptions of hypothetical samples corresponding to 23 species of gilled mushrooms in the Agaricus and Lepiota Family (pp. 500-525). Each species is identified as definitely edible, definitely poisonous, or of unknown edibility and not recommended. This latter class was combined with the poisonous one. The Guide clearly states that there is no simple rule for determining the edibility of a mushroom; no rule like ``leaflets three, let it be'' for Poisonous Oak and Ivy. Sources: (a) Mushroom records drawn from The Audubon Society Field Guide to North American Mushrooms (1981). G. H. Lincoff (Pres.), New York: Alfred A. Knopf (b) Donor: Jeff Schlimmer (Jeffrey.Schlimmer@a.gp.cs.cmu.edu) (c) Date: 27 April 1987 Number of Instances: 8124; Number of Attributes: 22 (all nominally valued) Mushroom: original data were alphanumeric. replace alphanumeric attributes in order mentioned by 1, 2, 3 etc

9 y x 1 x 3 x N  f() w 1 w 2 w 3 w N McCulloch-Pitts Neuron

10  f()      x 1 x 2 w 11  w 12  w 13  w 23  w 22  w 11  w 32  w 21  w 11  y First hidden layer Second hidden layer Output neuron Neural Network As Collection of M-P Neurons

11 Kohonen SOM for text retrieval on WWW newsgroups WEBSOM node u21 Click arrows to move to neighboring nodes on the map. Instructions Re: Fuzzy Neural Net References Needed Derek Long, 27 Oct 1995, Lines: 24. Distributed Neural Processing Jon Mark Twomey, 28 Oct 1995, Lines: 12. Re: neural-fuzzy TiedNBound, 11 Dec 1995, Lines: 10. New neural net C library available Simon Levy, 2 Feb 1996, Lines: 15. Re: New neural net C library available Michael Glover, Sun, 04 Feb 1996, Lines: 25.

12 From Guido De Boeck SOM’s for Data Mining To be published (Springer Verlag)

13 database data prospecting and surveying selected data select transformed data preprocess & transform make model Interpretation& rule formulation The Data Mining Process

14 Santa Fe Time Series Prediction Competition 1994 Santa Fe Institute Competition: 1000 data chaotic laser data, predict next 100 data Competition is described in Time Series Prediction: Forecasting the Future and Understanding the Past, A. S. Weigend & N. A. Gershenfeld, eds., Addison-Wesley, 1994 Method: - K-PLS with  = 3 and 24 latent variables - Used records with 40 past data for training for next point - Predictions bootstrap on each other for 100 real test data Entry “would have won” the competition

15 UNDERSTANDING WISDOM DATA INFORMATION KNOWLEDGE

16 Docking Ligands is a Nonlinear Problem

17 Surface properties are encoded on 0.002 e/au 3 surface Breneman, C.M. and Rhem, M. [1997] J. Comp. Chem., Vol. 18 (2), p. 182-197 Histograms or wavelet encoded of surface properties give Breneman’s TAE property descriptors 10x16 wavelet descriptore Electron Density-Derived TAE-Wavelet Descriptors PIP (Local Ionization Potential) Histograms Wavelet Coefficients

18 PLS, K-PLS, SVM, ANN Feature Selection (data strip mining)

19 Binding affinities to human serum albumin (HSA): log K’hsa Gonzalo Colmenarejo, GalaxoSmithKline J. Med. Chem. 2001, 44, 4370-4378 95 molecules, 250-1500+ descriptors 84 training, 10 testing (1 left out) 551 Wavelet + PEST + MOE descriptors Widely different compounds Acknowledgements: Sean Ekins (Concurrent) N. Sukumar (Rensselaer)

20 Microarray Gene Expression Data for Detecting Leukemia 38 data for training 36 data for testing Challenge: select ~10 out of 6000 genes used sensitivity analysis for feature selection (with Kristin Bennett)

21 GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAACACCA CCATCATTATCACCACCACCACCATCACCAACATCACCACCATCATCATCACCACCATCA CCAAGACCATCATCATCACCATCACCACCAACATCACCACCATCACCAACACCACCATCA CCACCACCACCACCATCATCACCACCACCACCATCATCATCACCACCACCGCCATCATCA TCGCCACCACCATGACCACCACCATCACAACCATCACCACCATCACAACCACCATCATCA CTATCGCTATCACCACCATCACCATTACCACCACCATTACTACAACCATGACCATCACCA CCATCACCACCACCATCACAACGATCACCATCACAGCCACCATCATCACCACCACCACCA CCACCATCACCATCAAACCATCGGCATTATTATTTTTTTAGAATTTTGTTGGGATTCAGT ATCTGCCAAGATACCCATTCTTAAAACATGAAAAAGCAGCTGACCCTCCTGTGGCCCCCT TTTTGGGCAGTCATTGCAGGACCTCATCCCCAAGCAGCAGCTCTGGTGGCATACAGGCAA CCCACCACCAAGGTAGAGGGTAATTGAGCAGAAAAGCCACTTCCTCCAGCAGTTCCCTGT GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAACACCA CCATCATTATCACCACCACCACCATCACCAACATCACCACCATCATCATCACCACCATCA CCAAGACCATCATCATCACCATCACCACCAACATCACCACCATCACCAACACCACCATCA CCACCACCACCACCATCATCACCACCACCACCATCATCATCACCACCACCGCCATCATCA TCGCCACCACCATGACCACCACCATCACAACCATCACCACCATCACAACCACCATCATCA CTATCGCTATCACCACCATCACCATTACCACCACCATTACTACAACCATGACCATCACCA CCATCACCACCACCATCACAACGATCACCATCACAGCCACCATCATCACCACCACCACCA CCACCATCACCATCAAACCATCGGCATTATTATTTTTTTAGAATTTTGTTGGGATTCAGT ATCTGCCAAGATACCCATTCTTAAAACATGAAAAAGCAGCTGACCCTCCTGTGGCCCCCT TTTTGGGCAGTCATTGCAGGACCTCATCCCCAAGCAGCAGCTCTGGTGGCATACAGGCAA CCCACCACCAAGGTAGAGGGTAATTGAGCAGAAAAGCCACTTCCTCCAGCAGTTCCCTGT WORK IN PROGRESS

22 Direct Kernel with Robert Bress and Thanakorn Naenna

23 with Wunmi Osadik and Walker Land (Binghamton University) Acknowledgement: NSF

24 Magneto-cardiogram Data with Karsten Sternickel (Cardiomag Inc.) and Boleslaw Szymanski (Rensselaer) Acknowledgemnent: NSF SBIR phase I project

25 Direct Kernel PLS with 3 Latent Variables

26 SVMLib Linear PCA Direct Kernel PLS SVMLib

27 www.drugmining.com Kristin Bennett and Mark Embrechts

Download ppt "Soft Computing & Computational Intelligence Biologically inspired computing models Compatible with human expertise/reasoning Intensive numerical computations."

Similar presentations

The Software Infrastructure for Electronic Commerce Databases and Data Mining Lecture 4: An Introduction To Data Mining (II) Johannes Gehrke

The Software Infrastructure for Electronic Commerce Databases and Data Mining Lecture 4: An Introduction To Data Mining (II) Johannes Gehrke
Presented at the Alabany Chapter of the ASA February 25, 2004 Washinghton DC.

Presented at the Alabany Chapter of the ASA February 25, 2004 Washinghton DC.
Evolutionary Neural Logic Networks for Breast Cancer Diagnosis A.Tsakonas 1, G. Dounias 2, E.Panourgias 3, G.Panagi 4 1 Aristotle University of Thessaloniki,

Evolutionary Neural Logic Networks for Breast Cancer Diagnosis A.Tsakonas 1, G. Dounias 2, E.Panourgias 3, G.Panagi 4 1 Aristotle University of Thessaloniki,
Neural Network I Week 7 1. Team Homework Assignment #9 Read pp. 327 – 334 and the Week 7 slide. Design a neural network for XOR (Exclusive OR) Explore.

Neural Network I Week 7 1. Team Homework Assignment #9 Read pp. 327 – 334 and the Week 7 slide. Design a neural network for XOR (Exclusive OR) Explore.
Data Mining Classification: Alternative Techniques

Data Mining Classification: Alternative Techniques
Final Project- Mining Mushroom World. Agenda Motivation and Background Determine the Data Set (2) 10 DM Methodology steps (19) Conclusion.

Final Project- Mining Mushroom World. Agenda Motivation and Background Determine the Data Set (2) 10 DM Methodology steps (19) Conclusion.
Support Vector Machines

Support Vector Machines
Outcomes  Look at the theory of self-organisation.  Other self-organising networks  Look at examples of neural network applications.

Outcomes  Look at the theory of self-organisation.  Other self-organising networks  Look at examples of neural network applications.
Artificial Neural Networks

Artificial Neural Networks
S-SENCE Signal processing for chemical sensors Martin Holmberg S-SENCE Applied Physics, Department of Physics and Measurement Technology (IFM) Linköping.

S-SENCE Signal processing for chemical sensors Martin Holmberg S-SENCE Applied Physics, Department of Physics and Measurement Technology (IFM) Linköping.
Machine Learning: Connectionist McCulloch-Pitts Neuron Perceptrons Multilayer Networks Support Vector Machines Feedback Networks Hopfield Networks.

Machine Learning: Connectionist McCulloch-Pitts Neuron Perceptrons Multilayer Networks Support Vector Machines Feedback Networks Hopfield Networks.
1 DNA Classifications with Self-Organizing Maps (SOMs) Thanakorn Naenna Mark J. Embrechts Robert A. Bress May 2003 IEEE International Workshop on Soft.

1 DNA Classifications with Self-Organizing Maps (SOMs) Thanakorn Naenna Mark J. Embrechts Robert A. Bress May 2003 IEEE International Workshop on Soft.
Machine Learning Neural Networks

Machine Learning Neural Networks
1 Introduction to Bio-Inspired Models During the last three decades, several efficient machine learning tools have been inspired in biology and nature:

1 Introduction to Bio-Inspired Models During the last three decades, several efficient machine learning tools have been inspired in biology and nature:
Prénom Nom Document Analysis: Artificial Neural Networks Prof. Rolf Ingold, University of Fribourg Master course, spring semester 2008.

Prénom Nom Document Analysis: Artificial Neural Networks Prof. Rolf Ingold, University of Fribourg Master course, spring semester 2008.
Direct Kernel Methods. Data mining is the process of automatically extracting valid, novel, potentially useful and ultimately comprehensible information.

Direct Kernel Methods. Data mining is the process of automatically extracting valid, novel, potentially useful and ultimately comprehensible information.
Artificial Neural Networks Artificial Neural Networks are (among other things) another technique for supervised learning k-Nearest Neighbor Decision Tree.

Artificial Neural Networks Artificial Neural Networks are (among other things) another technique for supervised learning k-Nearest Neighbor Decision Tree.
Data Mining with Neural Networks

Data Mining with Neural Networks
Presented at the Alabany Chapter of the ASA February 25, 2004 Washinghton DC.

Presented at the Alabany Chapter of the ASA February 25, 2004 Washinghton DC.
Analyze/StripMiner ™ Overview To obtain an idiot’s guide type “analyze > readme.txt” Standard Analyze Scripts Predicting on Blind Data PLS (Please Listen.

Analyze/StripMiner ™ Overview To obtain an idiot’s guide type “analyze > readme.txt” Standard Analyze Scripts Predicting on Blind Data PLS (Please Listen.

Similar presentations

Ads by Google