1. Visualization of genomic data Genome browsers

2. How many have used a genome browser ? UCSC browser ? Ensembl browser ? Others ? survey

3. Visualization of genomic data Genome browsers

4. Genome browsers Visualization of a gene >sequence ATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGC GTCCGCCTTCCCGCTGCCCGCCGGTAAGAGGCCTCCCGAGGCGCCCGCCG AAGACCGCTCCCTCGGCCGCCGCCGCGCGCCCTTCGCGCTGAGCAGTGAC TGTAAGAACCGTTCCCTCCCCGCGGGGGGGCCGCCGGCGGACCCCCTCGC ACCCCCACCCGCAGCCAGCCCCGCACGTACCCCAAGCCAGCCTGATGGCT GTGTGGCCTACCGACCCGTGGGCAAGGGGTGCGGGTGCTGAAGCCCCCAG GGGTGCCTGGCTGCCCACTGCTGCCCGCACGCCTGGCCTGAAAGTGACAC GCGCTGGTTTGCCCAGCACAGAGGGGATGGAATTTTTATGCTGCTCCTTT AGCATTCTGATGAACAAATATCCTCCCCACCAGCACCACCACCTCAGAAA Chr5123.004.678 123.404.678124.987.012125.345.112 Flat files / tab files

5. Genome browsers Why graphic Display ? Why is a graphic display better than Flat files / tab files A graphic display is compact Meta data available i.e. Support information about a gene Experimental evidence like EST Predicted gene structures SNP information Links to many databases In short much data about a gene is gathered is one place and can be viewed easily.

6. Genome browsers Visualization of a gene (Ensembl)

7. Genome browsers Visualization of a gene (UCSC) Exon Intron UTR

8. Genome browsers

10. UCSC genome browser http://genome.ucsc.edu/ Easy to use Often updates, but not as often as Ensembl upload of personal tracks Ensembl browser http://www.ensembl.org/index.html Less easy to use Maintained/updated by several people Gbrowser http://www.gmod.org/GBrowse Genome browsers

11. UCSC genome browser Basic functionalities Finding a gene by name by sequence Gene structure Sequence orthologues Single Nucleotide Polymorphisms Gene Sorter - sort according to expression, homology... Custom tracks

12. BLAT genome Browser http://genome.ucsc.edu//

13. BLAT genome Browser Using a search term or position eg Chr1:10,234-11,567

14. BLAT genome Browser http://genome.ucsc.edu/

15. BLAT genome Browser Using a protein or DNA sequence

16. BLAT Blast Like Alignment Tool BLAT (2002) Very fast searches (MySQL database) Handle introns in RNA/DNA alignments Data for more that 30 genomes (human, mouse, rat…) Exon Intron Exon Splice sites

17. Blat genome Browser

18. BLAT genome Browser ”Details” Correct splice site ?

19. Logo Plot Information Content IC = -H(p) + log 2 (4) =  a p a log 2 p a + 2 The Information content is calculated from a multiple sequence alignment. Result is a graphical visualization of sequence conservation where: Total height at a position is the Information Content Height of single letter is proportional to the frequency of that letter Mutiple alignment of 3 protein sequences: Seq1: A L R K P Q R T Seq2: A V R H I L L I Seq3: A I K V H N N T Pos1: I = -[1*log 2 (1)]+ 4.32 = log 2 (20) = 4.32 Pos2: I = -[1/3*log 2 (1/3)+ 1/3*log 2 (1/3)+ 1/3*log 2 (1/3)] + 4.32 = 2.73 Pos3: I = -[2/3*log 2 (2/3)+ 1/3*log 2 (1/3) + 4.32 = 3.38

20. Logo Plot Exon

21. BLAT genome Browser ”Details” Correct splice site ?

22. BLAT genome Browser ”Details” Donor site | Acceptor site exon.... G | GT...intron...AG | exon...

23. Blat genome Browser

24. BLAT genome Browser ”Browser” Base, Center & Zoom Known genes Predictions RNA EST Conservation Expression

25. BLAT genome Browser Center & zoom

26. Forward/reverse direction Selected number of tracks

27. BLAT genome Browser Sequence Orthologs

28. “klick”

29. BLAT genome Browser Sequence Orthologs

32. SNPs

34. Chromosomal locus A locus is a physical location on a chromosome p the ‘short arm’ q the ‘long arm’ A locus range may describe a location of a gene 22q11.21-q11.23 22q12.2 Chromosome22 Armq Band12 Sub-band2

35. Chromosomal locus Searching with gene name

36. Chromosomal locus Searching with locus range

37. Custom tracks Upload your personal data Share data with colleagues Data need to be related to a reference organism

38. Custom tracks

40. Exercise 1.Basic understanding of the graphics 2.Effect of Single Nucleotide Polymorphisms (SNPs) 3.Finding Orthologue genes 4.Identify chromosomal locus for a gene