1. Questions How does RNA polymerase work and what does it make? How does it know where to start and stop? How does a ribosome work and what does it make? How does it know where to start and stop? If the DNA in every cell in your body is the same why don't your adipose (fat) cells secrete epinephrine? If the DNA contains all of the information why doesn't the ribosome just 'read' it? Why have intermediate steps? Looking at RNA ECB2 7.1

2. Making a cytosolic protein: Step 1--transcribe Genes encode proteins Why use an RNA step? Major steps in process: Initiation, Elongation and Termination animation

3. Initiation

4. DNA-RNA interactions DNA Template strandComplementary RNA strand DNA/RNA Hybrid Adapted from Life; Purves 6thed Watching Transcription EBC2 7.2 http://www.johnkyrk.com/DNAtranscription.html http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/transcription.swf Check out

5. Translation: Converting the blueprint into a working model 36” 72’ Grade P red oak, inlay mahaog

6. Nucleotides to proteins: Step II Are cytosolic and integral membrane proteins transcribed the same way? Are they translated the same way? Questions:

7. Three basic steps From nucleotides to amino acids---How? InitiationElongationTermination Fig 4-26

8. Two adaptors used: tRNA and amino acyl tRNA-synthetases *Codons, Anticodons, and Wobble *‘Charging’ of tRNA *Basepairing with a tRNA Fig4-26 *Using Inosine w/ A, U, or C Fig 4-28

9. That Degenerate Genetic code # codons > # tRNAs > # aminoacids How did they figure out the genetic code? Strings of identical nucleotides Nirenberg CCAGAGCAGACUGCUUAGCUUCAUCCCACGAACGGGAG P E Q T A STOP L H P T N G ? Q S R L L S F I P R T G R A D C L A S S H E R E

10. Players? How does the complex know where to start translating? In Bacteria? In eukaryotes? 3’ mRNA 5’ AAAAAAAA Initiation factors IFs Small subunit of ribosome Initiator tRNA Met Once initiation complex forms large subunit of ribosome is recruited

11. Elongation Players? mRNA Aminoacyl- tRNAs Elongation factors Ribosome Requires GTP hydrolysis Results in peptide bond formation Chain grows from N to C P site A site E site CBI 6.4 Translation

12. Termination Players? mRNA Termination factors Ribosome Fig 4-40 How does it work? Why does the chain end?

13. The Protein What happens to the protein? Folding Sorting What happens to the mRNA, the ribosomes & the tRNA? Reuse Polysomes

14. Translation, Bipolar Disorder, and …… What does this have to do with bipolar disorder? Nobel Prize for Medicine 2000: Dopamine as a neurotransmitter and its role in brain dysfunctions (Dopamine is the catecholamine implicated in bipolar disorder) Biaxial Theory ‘Most simply, manic states are here understood as the clinical expression, at one point in time, of excessive synaptic neurochemical capacity within the primary affective system, and depressive states as the clinical expression of neurotransmitter depletion’ Askland and Parsons (2006)

15. Tale of 2 proteins--a stretched metaphor Neuropeptides synthesized in cytosol sorted/packaged into vesicles for use. (as is dopamine- but not through translation) Protein 1: Many neurotransmitters are amino acids, amino acid derivatives (like dopamine), or short peptides Protein 2: Neurotransmitter receptors are proteins. Synthesized in cytosol, inserted into ER membrane and sent to proper location on plasma membrane Broad Hypothesis: Perhaps Bipolar is a result of problem(s) Getting the transmitters or the receptors to the right place at the right time. (neurochemical part of biaxial theory)

16. Broad Idea: Perhaps Bipolar is a result of problem(s) getting the transmitters or the receptors to the right place at the right time? How do we study this?--- examine what ‘should’ happen and look for changes from that ‘standard’

17. Synaptic vesicles What are they? Vesicles are membrane spheres Neurotransmitters are polar How do they get in? How does neurotransmitter packaging occur?