Presentation is loading. Please wait.

Presentation is loading. Please wait.

Covariance in RNA ref " 1 72. Covariance M ij =  fx i x j log 2 [fx i x j /(fx i fx j )] M=0 to 2 bits; x=base type x i x j see Durbin et al p. 266-8.

Published byBruce Day Modified over 8 years ago

Similar presentations

Presentation on theme: "Covariance in RNA ref " 1 72. Covariance M ij =  fx i x j log 2 [fx i x j /(fx i fx j )] M=0 to 2 bits; x=base type x i x j see Durbin et al p. 266-8."— Presentation transcript:

1 Covariance in RNA ref " 1 72

2 Covariance M ij =  fx i x j log 2 [fx i x j /(fx i fx j )] M=0 to 2 bits; x=base type x i x j see Durbin et al p. 266-8. D-stem anticodon TCTC 3’acc

3 Mutual Information ACUUAU M 1,6 =  = fAU log 2 [fAU/(fA*fU)]... CCUUAG x 1 x 6 GCUUGC =4*.25log 2 [.25/(.25*.25)]=2 UCUUGA i =1 j =6 M 1,2 = 4*.25log 2 [.25/(.25*1)]=0 M ij =  fx i x j log 2 [fx i x j /(fx i fx j )] M=0 to 2 bits; x=base type x i x j see Durbin et al p. 266-8. See Shannon entropy, multinomial GrendarGrendar

4  trp/  tyrA pair of genomes shows the best co-growth Reppas, Lin & Church ; Shendure et al. Accurate Multiplex Polony Sequencing of an Evolved Bacterial Genome(2005) Science 309:1728 Second Passage First Passage Covariance in lab evolution

5 Sequence monitoring of evolution (optimize transport & drug resistance) Sequence Reppas, Lin & Church

6 Co-evolution of mutual biosensors/biosynthesis sequenced across time & within each time-point Independent lines of Trp  & Tyr  co-culture 5 OmpF: (pore: large,hydrophilic > small) 42R-> G,L,C, 113 D->V, 117 E->A 2 Promoter: (cis-regulator) -12A->C, -35 C->A 5 Lrp: (trans-regulator) 1b , 9b , 8b , IS2 insert, R->L in DBD. Heterogeneity within each time-point. Shendure J, Porreca GJ, et al. 2005. Accurate multiplex polony sequencing of an evolved bacterial genome. Science 309: 1728-32

7 Flux ratios at each branch point yields optimal polymer composition for replication x,y are two of the 100s of flux dimensions

8 Non-optimal evolves to optimal Ibarra et al. Nature. 2002 Nov 14;420(6912):186-9. Escherichia coli K-12 undergoes adaptive evolution to achieve in silico predicted optimal growth.

9 Comparative genome sequencing of E. coli allows observation of bacterial evolution on a laboratory timescale. Herring et al 2006 Nat. Gen 38:1406

10 The Amino-acid Mutational Spectrum of Human Genetic Disease. Vitkup,D, Sander,C, Church,GM (2003) Genome Biol. 4: R72.Genome Biol. 4: R72.

11 Prediction of deleterious human alleles Shamil Sunyaev, Vasily Ramensky, Ina Koch, Warren Lathe III, Alexey S. Kondrashov, and Peer Bork Hum Mol Genet (2001) 10: 591-597 http://genetics.bwh.harvard.edu/pph/ http://polydoms.cchmc.org/polydoms/

12 Prediction Puzzles >example1 CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC

Download ppt "Covariance in RNA ref " 1 72. Covariance M ij =  fx i x j log 2 [fx i x j /(fx i fx j )] M=0 to 2 bits; x=base type x i x j see Durbin et al p. 266-8."

Similar presentations

Lets begin constructing the model… Step (I) - Definitions We begin with a very simple imaginary metabolic network represented as a directed graph: Vertex.

Lets begin constructing the model… Step (I) - Definitions We begin with a very simple imaginary metabolic network represented as a directed graph: Vertex.
Acquisition of tumour multidrug resistance inevitable in most advanced solid tumours – Failing to cure the majority of advanced solid tumours – Declining.

Acquisition of tumour multidrug resistance inevitable in most advanced solid tumours – Failing to cure the majority of advanced solid tumours – Declining.
Evolutionary Biology Group Isabel Gordo Genomes and Evolution.

Evolutionary Biology Group Isabel Gordo Genomes and Evolution.
But what if we test more than one locus? The future of genetic studies of complex human diseases. RefRef (Note above graphs are active spreadsheets --

But what if we test more than one locus? The future of genetic studies of complex human diseases. RefRef (Note above graphs are active spreadsheets --
A novel method for measuring codon usage bias and estimating its statistical significance Codon usage bias or CUB, a phenomenon in which synonymous codons.

A novel method for measuring codon usage bias and estimating its statistical significance Codon usage bias or CUB, a phenomenon in which synonymous codons.
Discovery of a rare arboreal forest-dwelling flying reptile (Pterosauria, Pterodactyloidea) from China Wang et al. PNAS Feb. 11, 2008.

Discovery of a rare arboreal forest-dwelling flying reptile (Pterosauria, Pterodactyloidea) from China Wang et al. PNAS Feb. 11, 2008.
MIT-OCW Health Sciences & Technology 508/510 Harvard Biophysics 101 EconomicsEconomics, Public Policy, Business, Health PolicyPublic PolicyBusinessHealth.

MIT-OCW Health Sciences & Technology 508/510 Harvard Biophysics 101 EconomicsEconomics, Public Policy, Business, Health PolicyPublic PolicyBusinessHealth.
OEB 192 – 10.11.01 Genetic & physiological basis of adaptation (Goddard et al., 2005. Nature) (Cooper, 2007. PLoS Biol.)

OEB 192 – Genetic & physiological basis of adaptation (Goddard et al., Nature) (Cooper, PLoS Biol.)
The Structure, Function, and Evolution of Biological Systems Instructor: Van Savage Spring 2010 Quarter 4/6/2010.

The Structure, Function, and Evolution of Biological Systems Instructor: Van Savage Spring 2010 Quarter 4/6/2010.
Genome Evolution. Amos Tanay 2009 Genome evolution Lecture 10: Comparative genomics, non coding sequences.

Genome Evolution. Amos Tanay 2009 Genome evolution Lecture 10: Comparative genomics, non coding sequences.
Accurate Multiplex Polony Sequencing of an Evolved Bacterial Genome Jay Shendure, Gregory J. Porreca, Nikos B. Reppas, Xiaoxia Lin, John P. McCutcheon.

Accurate Multiplex Polony Sequencing of an Evolved Bacterial Genome Jay Shendure, Gregory J. Porreca, Nikos B. Reppas, Xiaoxia Lin, John P. McCutcheon.
Evolution of minimal metabolic networks WANG Chao April 11, 2006.

Evolution of minimal metabolic networks WANG Chao April 11, 2006.
Human non-synonymous SNP: molecular function, evolution and disease Shamil Sunyaev Genetics Division, Brigham & Women’s Hospital Harvard Medical School.

Human non-synonymous SNP: molecular function, evolution and disease Shamil Sunyaev Genetics Division, Brigham & Women’s Hospital Harvard Medical School.
Revision of Chapter III For an information source {p i, i=1,2,…,N} its entropy is defined by Shannon’s first theorem: For an instantaneous coding, we have.

Revision of Chapter III For an information source {p i, i=1,2,…,N} its entropy is defined by Shannon’s first theorem: For an instantaneous coding, we have.
Molecular Genomic Imaging Center (CEGS) Harvard / Wash U George Church, Rob Mitra Greg Porreca, Jay Shendure Sequencing by Ligation on Polony Beads with.

Molecular Genomic Imaging Center (CEGS) Harvard / Wash U George Church, Rob Mitra Greg Porreca, Jay Shendure Sequencing by Ligation on Polony Beads with.
Adaptive evolution of bacterial metabolic networks by horizontal gene transfer Chao Wang Dec 14, 2005.

Adaptive evolution of bacterial metabolic networks by horizontal gene transfer Chao Wang Dec 14, 2005.
Morten Sommer, MIT/Harvard DOE GtL Center Novozyme 30-Jun-2006 CAD for Synthetic Microbial Biofuels.

Morten Sommer, MIT/Harvard DOE GtL Center Novozyme 30-Jun-2006 CAD for Synthetic Microbial Biofuels.
Bacterial Physiology (Micr430) Lecture 1 Overview of Bacterial Physiology (Text Chapters: 1 and 2)

Bacterial Physiology (Micr430) Lecture 1 Overview of Bacterial Physiology (Text Chapters: 1 and 2)
Molecular Evolution with an emphasis on substitution rates Gavin JD Smith State Key Laboratory of Emerging Infectious Diseases & Department of Microbiology.

Molecular Evolution with an emphasis on substitution rates Gavin JD Smith State Key Laboratory of Emerging Infectious Diseases & Department of Microbiology.
Positional Cloning LOD Sib pairs Chromosome Region Association Study Genetics Genomics Physical Mapping/ Sequencing Candidate Gene Selection/ Polymorphism.

Positional Cloning LOD Sib pairs Chromosome Region Association Study Genetics Genomics Physical Mapping/ Sequencing Candidate Gene Selection/ Polymorphism.

Similar presentations

Ads by Google