1. Topic 3 Genetics Which of these are determined by DNA? Skin colour Freckles Number of fingers on each hand Blood type Colour blindness Sex (male/female) Ability to digest lactose Reflexes Type of ear wax (wet or dry) A scar from an accident Ability to speak Ability to speak Spanish Height Personality Intelligence

2. Genes Chromosome Chromatid Centromere Homologous Chromosome Allele Genome

3. Gene Heritable factor that consists of a length of DNA and influences a specific characteristic

4. Allele Variations or versions of a gene

5. Genome Complete set of an organism’s base sequences How many codons are in this sequence? GTGGACCTGACTCCTGAGGAG 7 codons Complete genomes of some organisms have been worked out: Escherichia coli, Drosophila melanogaster, Homo sapiens

6. Human Genome Project 1990 international cooperative project to sequence the complete human genome 2003 succeeded in achieving its goal Now scientists are working on deciphering genes Before only 100 loci were known for genetic diseases, now 1400 known

7. Genome Databases In targets, you will use this database to determine the number of genes/size of genes in humans with other species http://www.ncbi.nlm.nih.gov/genome/

8. A Mutation is a change in DNA Mutations are rare but can be caused by many factors: A mistake in DNA replication Radiation Oxidants in the environment Cell Phone signals www.virtualsciencefair.orgwww.virtualsciencefair.org/ 2007/knig7d2/image... UV, Xray, gamma

9. Base Substitution mutation caused by a change in one base. may change an amino acid in the polypeptide chain This may have no affect or a great effect: A change in one amino acid may change the shape of a protein so that it does not work as well, or at all. Sickle cell anemia: a change in the GAG codon to GTG. Causes a valine to be added to the protein instead of glutamic acid. http://www.studentgroups.ucla.edu/citylab/images/SickleCell.jpg

10. "Genetic Code." Science Online. Facts On File, Inc. Web. 19 Nov. 2013. normal Sickle cell mutation

11. http://scienceofknowing.files.wordpress.com/2012/12/codon- chart.jpg?w=408 normal Sickle cell mutation

12. http://www.magrinscience.com/wp- content/uploads/2013/02/codon-chart.png normal Sickle cell mutation

13. so, the hemoglobin molecule that uses that protein has a different shape as does the red blood cell. The cell cannot carry oxygen well which results in symptoms of weakness, shortness of breath and fatigue. http://library.thinkquest.org/06aug/00440/images/sicklecellincapillary.jpg http://www.rougevalley.ca/growth/images/sicklecell04_rev_280x210.jpg

14. Hemoglobin crystalizes in sickle cells making them less flexible. This can cause blockage of capillaries Because this gene is found in every cell of the body, it can be passed on to the next generation.

15. Sickle Cell Anemia video http://www.youtube.com/watch?v=ujf72mjy0Bg Watch video then answer homework 4.1 questions

16. Homework 1. How do you think the symptoms of sickle cell anemia might affect a young person’s life? 2. What do you think would be the psychological affects of being told you have such a gene mutation? 3. If you had the gene for sickle cell anemia, would you want to know the chances of your future children getting it? Would it affect your decision of whether or not to marry someone who may also carry the gene? 4. If you had the opportunity to screen the embryos of your future children, would you do it? If yes, what would you do to the embryos which were discovered to be affected by sickle cell anemia?

17. 5. Do you think that parents should have the opportunity to abort if they knew their unborn baby was affected? Why or why not? 6. Should carriers of the condition be obliged to get advice from a genetic counselor before having children?