1. From DNA to Proteins DNAmRNAProtein TranscriptionTranslation

2. RNA Structure Structure: Consists of a long chain of nucleotides. 5-carbon sugar (ribose), phosphate group, and nitrogen base. Generally single-stranded. Instead of thymine (T) RNA contains uracil (U).

3. Types of RNA Types: (Fig 12-12, pg 300) mRNA: messenger RNA that carry copies of DNA instructions for making proteins. rRNA: ribosomal RNA is located in Ribosomes. tRNA: transfer RNA transfers each amino acid to the ribosome to match up with the messages in mRNA.

4. fromtoto make up Section 12-3 also calledwhich functions toalso called which functions to can be RNA Messenger RNA Ribosomal RNA Transfer RNA mRNACarry instructions rRNA Combine with proteins tRNA Bring amino acids to ribosome DNARibosomeRibosomes

5. Compare and Contrast DNA & RNA DNARNA Similarities

6. TRANSCRIPTION

7. Transcription RNA polymerase binds to DNA and separates the DNA strands and makes a complementary copy of mRNA RNA polymerase attaches to a promoter to begin transcription. TATA box Instead of thymine (T), uracil (U) matches up with adenine (A) in RNA. RNA polymerase stops and falls off when it reaches a termination sequence

8. RNA DNA RNA polymerase Transcription Section 12-3 Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) Animation

9. Check for Understanding What are the two jobs of RNA polymerase? What is the promoter sequence that RNA polymerase will bind to? What tells RNA polymerase where to stop? Transcribe the following DNA sequence: TATAAGCCTGGACATGCAATCTA

10. The Genetic Code The mRNA provides the code for the formation of proteins. Codons: 3 consecutive nucleotides that specify a single amino acid that is to be added to the polypeptide.

11. The Genetic Code Section 12-3

12. Example If the original mRNA was: UCGGACGGU What would the codons be? UCG—GAC—GGU What would the amino acid sequence be? (Use Figure 12-17, pg 303 to find out). Serine—Aspartic Acid—Glycine would be the amino acid sequence. Now try this sequence AUGAAUGUACAGAUGUUGUUCUGA

13. Answer Methionine—Asparagine—Valine— Glutamine—Methionine—Leucine— Phenylalanine—Stop Now try to find the code from the DNA sequence to the amino acid sequence: DNA: TACTTACCGACT Find the amino acid sequence! Answer: Methionine—Asparagine—Glycine— Stop

14. Translation mRNA is transcribed in the nucleus and goes to the cytoplasm of the cell. AUG is the start codon (Methionine). tRNA has the anticodon for the mRNA codon and an amino acid is attached to it. Ribosomes are positioned on the mRNA at the start codon and tRNA binds methionine to start the polypeptide chain. The ribosome then binds the next tRNA anticodon to the mRNA codon.

15. Section 12-3

16. Translation Continued The ribosome joins the two amino acids and the first tRNA is release. The ribosome moves to the next mRNA codon and the next amino acid is connected to the polypeptide chain. The process continues until the STOP codon is reached when the chain is complete.

17. Section 12-3

18. From DNA to Proteins DNAmRNAProtein TranscriptionTranslation

19. Transcribe This DNA Sequence: DNA Code: CTGAACTATAAAGCCAACTAC GGTTCGGTCAAACATCCGATC