2. Chapter 14 From Gene to Protein

3. Metabolism Teaches Us About Genes Metabolic defects  studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton a.k.a. homogentisic acid ) PKU (phenylketonuria)  each disease is caused by non-functional enzyme ABCDE Genes create phenotype…

5. 1 Gene – 1 Enzyme Hypothesis Beadle & Tatum  Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments  X-rays break DNA  inactivate a gene wild type grows on “minimal” media  sugars + required precursor nutrient to synthesize essential amino acids mutants require added amino acids  each type of mutant lacks a certain enzyme needed to produce a certain amino acid  non-functional enzyme = broken gene

6. Beadle & Tatum 1941 | 1958 George Beadle Edward Tatum

7. Beadle & Tatum’s Neurospora Experiment

8. So… What is a Gene? One gene – one enzyme  all proteins are coded by genes  but not all proteins are enzymes One gene – one protein  each protein has its own gene  but many proteins are composed of several polypeptides One gene – one polypeptide  but many genes only code for RNA One gene – one product  but many genes code for more than one product … Where does that leave us ?!

9. Defining a Gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 gene polypeptide 1 polypeptide 2 polypeptide 3 RNA gene It’s hard to hunt for wabbits, if you don’t know what a wabbit looks like.

10. protein RNA The “Central Dogma” DNA transcriptiontranslation replication How do we move information from DNA to proteins? For simplicity sake, let’s go back to genes that code for proteins…

11. From nucleus to cytoplasm… Where are the genes?  genes are on chromosomes in nucleus Where are proteins synthesized?  proteins made in cytoplasm by ribosomes How does the information get from nucleus to cytoplasm?  messenger RNA nucleus

12. RNA ribose sugar N-bases  uracil instead of thymine  U : A  C : G single stranded mRNA, rRNA, tRNA, siRNA…. RNA DNA transcription

13. Transcription Transcribed DNA strand = template strand  untranscribed DNA strand = coding strand Synthesis of complementary RNA strand  transcription bubble Enzyme that facilitates the building of RNA:  RNA polymerase

14. Role of promoter 1. Where to start reading = starting point 2. Which strand to read = template strand 3. Direction on DNA = always reads DNA 3'  5' Transcription Initiation  RNA polymerase binds to promoter sequence on DNA

15. Transcription Elongation  RNA polymerase unwinds DNA ~20 base pairs at a time  reads DNA 3’  5’  builds RNA 5’  3’ (the enzyme governs the synthesis!) No proofreading 1 error/10 5 bases many copies short life not worth it! No proofreading 1 error/10 5 bases many copies short life not worth it!

16. Transcription RNA

17. Transcription Termination  RNA polymerase stops at termination sequence  mRNA leaves nucleus through pores RNA GC hairpin turn

18. Prokaryote vs. Eukaryote Genetics Differences between prokaryotes & eukaryotes  time & physical separation between processes  RNA processing

19. Transcription in Eukaryotes only 1 prokaryotic enzyme 3 eukaryotic RNA polymerase enzymes  RNA polymerase I only transcribes rRNA genes  RNA polymerase I I transcribes genes into mRNA  RNA polymerase I I I only transcribes rRNA genes  each has a specific promoter sequence it recognizes

20. A A A A A 3' poly-A tail CH 3 mRNA 5' 5' cap 3' G PPP Eukaryotic Post-transcriptional Processing Primary transcript  eukaryotic mRNA needs work after transcription Protect mRNA  from RNA-ase enzymes in cytoplasm add 5' G cap add polyA tail Edit out introns eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA 50-250 A’s

21. Primary Transcript Processing mRNA  protecting RNA from RNase in cytoplasm add 5’ cap add polyA tail  remove introns AUGUGA

22. Protecting RNA 5’ cap added  G trinucleoside (G-P-P-P)  protects mRNA from RNase (hydrolytic enzymes) 3’ poly-A tail added  50-250 A’s  protects mRNA from RNase (hydrolytic enzymes)  helps export of RNA from nucleus UTR

23. Dicing & Splicing mRNA Pre-mRNA  mRNA  edit out introns intervening sequences  splice together exons expressed sequences  In higher eukaryotes 90% or more of gene can be intron no one knows why…yet  there’s a Nobel prize waiting… “ AVERAGE ” “ gene ” = 8000b pre-mRNA = 8000b mature mRNA = 1200b protein = 400aa lotsa “ JUNK ” !

24. snRNPs  small nuclear RNA  RNA + proteins Spliceosome  several snRNPs  recognize splice site sequence cut & paste RNA as ribozyme  some mRNA can splice itself  RNA as enzyme Splicing Enzymes

25. Ribozyme Sidney AltmanThomas Cech 1982 | 1989 YaleU of Colorado RNA as enzyme

26. Splicing Details No room for mistakes!  editing & splicing must be exactly accurate  a single base added or lost throws off the reading frame AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCUAUGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCUAUGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met | Arg | Ser | Asp | Lys | Gly | His Met | Arg | Val | Arg |STOP|

27. Alternative Splicing Alternative mRNAs produced from same gene  when is an intron not an intron…  different segments treated as exons Hard to define a gene!

28. Discovery of Split Genes 1977 | 1993 Richard RobertsPhilip Sharp NE BioLabsMIT adenovirus common cold

29. s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s Structure of Antibodies light chains antigen-binding site heavy chains antigen-binding site light chain light chain heavy chains B cell membrane variable region antigen-binding site Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y

30. Transcription of gene mRNA chromosome of undifferentiated B cell B cell C C D J DNA of differentiated B cell rearrangement of DNA V Translation of mRNA How do vertebrates produce millions of antibody proteins, if they only have a few hundred genes coding for those proteins? antibody By DNA rearrangement & somatic mutation vertebrates can produce millions of B & T cells

31. AAAAAAAAGTP 20-30b 3' promoter transcription stop transcription stop transcription start transcription start introns The Transcriptional Unit (gene?) transcriptional unit TACACT DNA TATA 5' RNA polymerase pre-mRNA 5'3' translation start translation start translation stop translation stop mature mRNA 5'3' UTR exons enhancer 1000 + b

32. Prokaryote vs. Eukaryote Genetics Prokaryotes  DNA in cytoplasm  circular chromosome  naked DNA  no introns Eukaryotes  DNA in nucleus  linear chromosomes  DNA wound on histone proteins  introns vs. exons eukaryotic DNA eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence

33. mRNA From Gene to Protein DNA transcription nucleus cytoplasm mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA aa ribosome protein translation

34. Translation in Prokaryotes Transcription & translation are simultaneous in bacteria  DNA is in cytoplasm  no mRNA editing needed

35. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? How Does DNA Code for Proteins

36. Cracking the Code Nirenberg & Matthaei  determined 1 st codon–amino acid match UUU coded for phenylalanine  created artificial poly(U) mRNA  added mRNA to test tube of ribosomes, tRNA & amino acids mRNA synthesized single amino acid polypeptide chain 1960 | 1968 phe–phe–phe–phe–phe–phe

37. Marshall NirenbergHeinrich Matthaei

38. Translation Codons  blocks of 3 nucleotides decoded into the sequence of amino acids

39. mRNA Codes for Proteins in Triplets mRNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC TACGCACATTTACGTACGCGG DNA Met Arg Val Asn Ala Cys Ala protein ? codon mRNA codes for proteins in triplets… CODONS!

40. The Code! For ALL life!  strongest support for a common origin for all life Code is redundant  several codons for each amino acid Why is this a good thing? Start codon  AUG  methionine Stop codons  UGA, UAA, UAG

41. 5'3' 5' TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA anti-codon codon UAC Met GCA Arg CAU Val amino acid tRNA 3'5' How are Codons Matched to Amino Acids?

42. protein transcription cytoplasm nucleus translation

43. tRNA Structure “Clover leaf” structure  anticodon on “clover leaf” end  amino acid attached on 3' end

44. Loading tRNA Aminoacyl tRNA synthetase  enzyme which bonds amino acid to tRNA  endergonic reaction ATP  AMP  energy stored in tRNA-amino acid bond unstable so it can release amino acid at ribosome

45. Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon  organelle or enzyme? Structure  ribosomal RNA (rRNA) & proteins  2 subunits large small

46. Ribosomes P site (peptidyl-tRNA site)  holds tRNA carrying growing polypeptide chain A site (aminoacyl-tRNA site)  holds tRNA carrying next amino acid to be added to chain E site (exit site)  empty tRNA leaves ribosome from exit site

47. Building a Polypeptide Initiation  brings together mRNA, ribosome subunits, proteins & initiator tRNA Elongation Termination

48. Elongation: Growing a Polypeptide

49. Termination: Release Polypeptide Release factor  “release protein” bonds to A site  bonds water molecule to polypeptide chain Now what happens to the polypeptide?

50. Protein Targeting Signal peptide  address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm ex. start of a secretory pathway

51. Can you tell the eukaryotic story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' cap polyA tail large subunit small subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA

52. Putting it all together… Don’t forget the YouTube videos!