1. Electrophoresis Gel Agarose Miss Noorulnajwa Diyana YaaCob School of Bioprocess Engineering Universiti Malaysia Perlis LECTURE 4 PTT 104 TECHNIQUES IN BIOTECHYNOLOGY

2. Agarose Gel Electrophoresis Gel electrophoresis is a widely used technique for the analysis of nucleic acids and proteins. Agarose gel electrophoresis is routinely used for the preparation and analysis of DNA. Gel electrophoresis is a procedure that separates molecules on the basis of their rate of movement through a gel under the influence of an electrical field. We will be using agarose gel electrophoresis to determine the presence and size of PCR products.

3. Components of Electrophoresis Electrical Current – the flow of electric charge Positive Electrode – the wire that collects electrons Negative Electrode – the wire that emits electrons Porous – containing pores, permeable to fluids and small particles Sieve – a mesh device to filter small particles out of a mixture of larger particles.

4. How Separation Occurs Electrical Charge: Many molecules (amino acids, peptides, proteins, DNA, and RNA) have naturally occurring negative and positive charges on them. The sum of these charges determines the overall charge. When introduced to an electrical current, negatively charged molecules are attracted to the positive electrode and positively charged molecules are attracted to the negative electrode. - + - + - + - + - + - + - - + - - - - Negatively Charged Protein - + - + + Positively Charged Peptide + N N O+ Positively Charged Amino Acid

5. Molecule Size: The porous material is made of microscopic particles suspended in a gel. The microscopic particles attach to one another forming tunnels that act as a sieve to separate the molecules. Small molecules can move faster than large molecules. Porous Materia l Proteins Entering Porous Material Smallest Move Fastest How Separation Occurs

6. DNA is negatively charged. +- Power DNA  When placed in an electrical field, DNA will migrate toward the positive pole (anode). HH O2O2 An agarose gel is used to slow the movement of DNA and separate by size. Scanning Electron Micrograph of Agarose Gel (1×1 µm)  Polymerized agarose is porous, allowing for the movement of DNA

7. +- Power DNA How fast will the DNA migrate? strength of the electrical field, buffer, density of agarose gel… Size of the DNA! *Small DNA move faster than large DNA …gel electrophoresis separates DNA according to size small large Within an agarose gel, linear DNA migrate inversely proportional to the log10 of their molecular weight.

8. Agarose Agarose is a linear polymer extracted from seaweed. D-galactose 3,6-anhydro L-galactose Sweetened agarose gels have been eaten in the Far East since the 17th century. Agarose was first used in biology when Robert Koch* used it as a culture medium for Tuberculosis bacteria in 1882 *Lina Hesse, technician and illustrator for a colleague of Koch was the first to suggest agar for use in culturing bacteria

9. Making an Agarose Gel

10. An agarose gel is prepared by combining agarose powder and a buffer solution. Agarose  Buffer  Flask for boiling 

11. Casting tray  Gel combs  Power supply  Gel tank   Cover Electrical leads  Electrophoresis Equipment

12. Gel casting tray & combs

13. Seal the edges of the casting tray and put in the combs. Place the casting tray on a level surface. None of the gel combs should be touching the surface of the casting tray. Preparing the Casting Tray

14. AgaroseBuffer Solution Combine the agarose powder and buffer solution. Use a flask that is several times larger than the volume of buffer.

15. Agarose is insoluble at room temperature (left). The agarose solution is boiled until clear (right). Gently swirl the solution periodically when heating to allow all the grains of agarose to dissolve. ***Be careful when boiling - the agarose solution may become superheated and may boil violently if it has been heated too long in a microwave oven. Melting the Agarose

16. Allow the agarose solution to cool slightly (~60ºC) and then carefully pour the melted agarose solution into the casting tray. Avoid air bubbles. Pouring the gel

17. Each of the gel combs should be submerged in the melted agarose solution.

18. When cooled, the agarose polymerizes, forming a flexible gel. It should appear lighter in color when completely cooled (30-45 minutes). Carefully remove the combs and tape.

19. Place the gel in the electrophoresis chamber.

20. buffer  Add enough electrophoresis buffer to cover the gel to a depth of at least 1 mm. Make sure each well is filled with buffer.  Cathode (negative) Anode  (positive)  wells  DNA 

21. 6X Loading Buffer:   Bromophenol Blue (for color)  Glycerol (for weight) Sample Preparation Mix the samples of DNA with the 6X sample loading buffer (w/ tracking dye). This allows the samples to be seen when loading onto the gel, and increases the density of the samples, causing them to sink into the gel wells.

22. Loading the Gel Carefully place the pipette tip over a well and gently expel the sample. The sample should sink into the well. Be careful not to puncture the gel with the pipette tip.

23. Place the cover on the electrophoresis chamber, connecting the electrical leads. Connect the electrical leads to the power supply. Be sure the leads are attached correctly - DNA migrates toward the anode (red). When the power is turned on, bubbles should form on the electrodes in the electrophoresis chamber. Running the Gel

24.  wells  Bromophenol Blue Cathode (-) Anode (+) Gel After the current is applied, make sure the Gel is running in the correct direction. Bromophenol blue will run in the same direction as the DNA. DNA (-) 

25.  100  200  300  1,650  1,000  500  850  650  400  12,000 bp  5,000  2,000 DNA Ladder Standard Inclusion of a DNA ladder (DNAs of know sizes) on the gel makes it easy to determine the sizes of unknown DNAs. - + DNA migration bromophenol blue  Note: bromophenol blue migrates at approximately the same rate as a 300 bp DNA molecule

26. As an alternative to purchasing costly DNA ladders, one can be created using meal worm (Tenebrio molitor) DNA and a restriction enzyme. http://people.uis.edu/rmosh1/DNAexerciseVIIa02.pdf

27. Staining the Gel ***CAUTION! Ethidium bromide is a powerful mutagen and is moderately toxic. Gloves should be worn at all times. Ethidium bromide binds to DNA and fluoresces under UV light, allowing the visualization of DNA on a Gel. Ethidium bromide can be added to the gel and/or running buffer before the gel is run or the gel can be stained after it has run.

28. Safer alternatives to Ethidium Bromide  Methylene Blue  BioRAD - Bio-Safe DNA Stain  Ward’s - QUIKView DNA Stain  Carolina BLU Stain …others advantages Inexpensive Less toxic No UV light required No hazardous waste disposal disadvantages Less sensitive More DNA needed on gel Longer staining/destaining time

29. Staining the Gel Place the gel in the staining tray containing warm diluted stain. Allow the gel to stain for 25-30 minutes. To remove excess stain, allow the gel to destain in water. Replace water several times for efficient destain.

30. Ethidium Bromide requires an ultraviolet light source to visualize

31. Visualizing the DNA (ethidium bromide)  100  200  300  1,650  1,000  500  850  650  400  5,000 bp  2,000 DNA ladder  DNA ladder  PCR Product 1 2 3 4 5 6 7 8 wells  + - - + - + + - Samples # 1, 4, 6 & 7 were positive for Wolbachia DNA Primer dimers 

32. Visualizing the DNA (QuikVIEW stain)  250  1,500  1,000  500  750  2,000 bp DNA ladder  PCR Product wells  + - - - - + + - - + - + March 12, 2006 Samples # 1, 6, 7, 10 & 12 were positive for Wolbachia DNA

33. SOUTHERN BLOTTING In 1975, Edwin Southern developed a dramatic improvement in gel electrophoresis. The method has been named Southern Blotting.

34. What Is Southern Blotting? A technique used in molecular biology to check for the presence of a particular DNA sequence in a DNA sample.

35. The Southern Blot takes advantage of the fact that DNA fragments will stick to a nylon or nitrocellulose membrane. The membrane is laid on top of the agarose gel and absorbent material (e.g. paper towels or a sponge) is placed on top. With time, the DNA fragments will travel from the gel to the membrane by capillary action as surrounding liquid is drawn up to the absorbent material on top. The membrane is now a mirror image of the agarose gel.

36. Performing Southern Blotting 1.DNA Digestion with an appropriate restriction enzyme. 2.Gel Electrophoresis run the digest on an agarose gel. 3.Denature the DNA (usually while it is still on the gel). 4.Transfer the denatured DNA to the membrane (blotting) 5.Preparing the probe 6.Hybridization Probe the membrane with labeled ssDNA. 7.Detection Visualize your radioactively labeled target sequence.

37. 1- DNA Digestion Cut the DNA into different sized pieces. HinfI restriction enzyme is used

38. 2- Gel Electrophoresis Sorts the DNA pieces by size Agarose or polyacrimide

39. Electrophoresis of Genomic DNA Odd numbered lanes contain undigested genomic DNA Even numbered lanes contain digested genomic DNA

40. 3- Denature the DNA DNA is then denatured with an alkaline solution such as NAOH. This causes the double stranded to become single-stranded.

41. 4- Blotting Transfer the DNA from the gel to a solid support. The blot is usually done on a sheet of nitrocellulose paper or nylon. Transferred by either electrophoresis or capillary blotting.

42. 4- Blotting 1) Electrophoresis- takes advantage of the molecules negative charge.

44. 4- Blotting 2) Capillary blotting-fragments are eluted from the gel and deposited onto the membrane by buffer that is drawn through the gel by capillary action. Buffer Wick (filter paper) Filter paper Agar gel with DNA Membrane Weight Paper towel stack

45. 4- Blot Fixation The blot is made permanent by: –Drying at ~80°C –Exposing to UV irradiation

46. 5- Preparing the probe It is a fragment of DNA of variable length (usually 100-1000 bases long), which is used to detect in DNA the presence of nucleotide sequences that are complementary to the sequence in the probe Must be labeled to be visualized Usually prepared by making a radioactive copy of a DNA fragment. Probing is often done with 32 P labeled ATP, biotin/streptavidin or a bioluminescent probe.

47. 6- Hybridization Hybridization-process of forming a double- stranded DNA molecule between a single- stranded DNA probe and a single-stranded target patient DNA.

48. probes 3’ – * ATCTCGGGAATC – 5’ add probe 5’ – … AAGCCTAGAGCCCTTAGCCAAAAG … – 3’ * ATCTCGGGAATC hybridization

49. 7- Detection Visualize your labeled target sequence. If radiolabeled 32 P probe is used, then you would visualize by autoradiography. Biotin/streptavidin detection is done by colorimetric methods, and bioluminescent visualization uses luminescence.

50. Steps in Southern Blotting Denaturation of patient’s DNA in gel Fragments of DNA appear as a smear cassette filter DNA extraction DNA digestion Gel electrophoresis Blot dismantled Hybridisation: Stringency washes Autoradiography Disease gene Gel in NaOH Southern blot Radioactive probe added to filter Nylon filter Paper towels Gel 10x SSC Chromatography paper support X ray film

51. Characterization: Southern blot hybridization - transfer of DNA from a gel to a membrane (e.g., nitrocellulose, nylon) -developed by Edwin Southern

52. Characterization: Northern blot hybridization - transfer of RNA from a gel to a membrane (e.g., nitrocellulose, nylon) -reveals mRNA size (and approximate protein size), tissue- and organ- specific expression, and kinetic patterns of expression X RNA X x salt X RNA

53. Characterization: Western blotting -transfer of protein from a gel to a membrane (e.g., nitrocellulose, nylon) -requires the use of an electric current to facilitate transfer X Protein X x Buffer; requires electric current X React with Antibody X Enzyme reaction or

54. Techniques in Biotechnology Biosensors

55. Outline Biosensor Background –What is a Biosensor? –Components of a Biosensor –Principles of Detection Biosensors on the Nanoscale –Current Research –Potential Applications Conclusion

56. What is a Biosensor? “Biosensor” once referred to any device which responds to chemical species in biological samples or using biological components. www.wvminesafety.org http://www.gentronix.co.uk/images/newscientist.jpg

57. Current Definition for Biosensors: A sensor that integrates a biological element with a physiochemical transducer to produce an electronic signal proportional to a single analyte which is then conveyed to a detector. www.imec.be/ovinter/static_research/BioHome.shtml

58. Components of a Biosensor http://www.dddmag.com/images/0409/HTS1_lrg.jpg Detector

59. 1 ST Component: Biological Element Microorganism Tissue Cell Organelle Nucleic Acid Enzyme Enzyme Component Receptor Antibody The component used to bind the target molecule. http://www.chemistry.wustl.edu/~edudev/LabTutorials/HIV/DrugStrategies.html Must be highly specific, stable under storage conditions, and immobilized.

60. 2 ND Component: Physiochemical Transducer Acts as an interface, measuring the physical change that occurs with the reaction at the bioreceptor then transforming that energy into measurable electrical output.

61. 3 RD Component: Detector Signals from the transducer are passed to a microprocessor where they are amplified and analyzed. The data is then converted to concentration units and transferred to a display or/and data storage device. www.modernmike.com

62. Principles of Detection measures change inmass measures change in electric distribution measures change in light intensity measures change inheat

63. Principles of Detection Piezo-Electric Biosensors The change in frequency is proportional to the mass of absorbed material. Some piezo-electric devices utilize crystals, such as quartz, which vibrate under the influence of an electric field. The frequency of this oscillation depends on their thickness and cut. electronics.howstuffworks.com Others use gold to detect the specific angle at which electron waves (surface plasmons) are emitted when the substance is exposed to laser light.

64. Principles of Detection Electrochemical Biosensors Amperometric for applied current: M ovement of e- in redox reactions detected when a potential is applied between two electrodes. Potentiometric for voltage: Change in distribution of charge is detected using ion-selective electrodes, such as pH-meters. Conductimetric for impedance http://www.lsbu.ac.uk/biology/enztech/index.html

65. Principles of Detection Optical Biosensors Colorimetric for color: Measure change in light adsorption as reactants are converted to products. Photometric for light intensity: Photon output for a luminescent or fluorescent process can be detected with photomultiplier tubes or photodiode systems. www.manimo.it/Prodotti/

66. Principles of Detection Calorimetric Biosensors If the enzyme catalyzed reaction is exothermic, two thermistors may be used to measure the difference in resistance between reactant and product and, hence, the analyte concentration. www4.tsl.uu.se/~Atlas/DCS/DCSIL/therm.html

67. Biosensors on the Nanoscale Current Research Dr. Michael Strano at the University of] Illinois, "We have developed molecular sheaths around the nanotube that respond to a particular chemical and modulate the nanotube's optical properties." http://www.worldchanging.com/archives/001727.html

68. Biosensors on the Nanoscale Current Research SPOT-NOSED Project: A layer of olfactory proteins on a nanoelectrode could react with low-concentration odorants. This technology could be used by doctors to diagnose diseases at earlier stages. http://www.sciencedaily.com/releases/2006/05/060515095600.htm

69. Biosensors on the Nanoscale Current Research Nanosphere lithography (NSL) derived triangular Ag nanoparticles were used to detect streptavidin down to one picomolar concentrations. http://www.chem.northwestern.edu/~vanduyne/pdf/MRS_723_O311-0316_2002.pdf http://faculty.washington.edu/stenkamp/stefanieweb/hydro.html

70. Biosensors on the Nanoscale Current Research The School of Biomedical Engineering has developed an anti-body based piezoelectric nanobiosensor to be used for anthrax,HIV hepatitis detection. http://www.biomed.drexel.edu/TechPort/Contents/Lec/Overview/Lec_BioSensors.pdf

71. Potential Applications Clinical diagnostics Food and agricultural processes Environmental (air, soil, and water) monitoring Detection of warfare agents.

72. How can Glucose Levels Be Measured Quickly? The basic idea is to couple biomolecules (enzymes, antibodies) or cells directly with sensors (electrode or optical sensors), amounting to their quasi-immobilization. Direct coupling enables analytes (glucose) to be converted by a biocomponent (GOD) into a biochemical signal (H 2 O 2 ) That is immediately passed on to the sensor.

73. The immobilized biocomponent is regenerated after use. In glucose sensors, the same GOD can be used to measure glucose in bloos samples approximately 10,000 times. Reusability was an important aspect for hospital labs which have to deal with hundreds of patients samples.

74. Microbial Yeast Sensors Biosensors using living immobilized microbes play an important part in environmental testing Yeasts such as Trichosporon cutaneum and Artxula adenivorans are the most frequently used species to measure the organic pollution

75. The idea using microbial sensors developed from the traditional measuring of the Biochemical Oxygen Demand in 5 days By using Microbial Sensors, only 5 minutes are required instead of 5 days. HOW????

76. The living yeast cells are immobilized in a polymer gel and mounted on an oxygen electrode. The sensor measures how much oxygen the “starving” cells are taking up. When clean water, containing non degradable substances, is added, the yeast does not take up additional oxygen.

77. Conclusion http://www.must.edu.my/~ccyeo/topics/biosensor.jpg The possibilities are endless!