Download presentation
Presentation is loading. Please wait.
Published byMolly Hardy Modified over 8 years ago
1
White (2n = 40) Hispanic (2n = 40) Black (2n = 40) Asian (2n = 40) Numbers in diamonds: LD as r 2 *100 LD blocks defined by four gamete rule r 2 color scheme: r 2 =0, white; 0<r 2 <1, shades of grey; r 2 =1: black. Linkage disequilibrium (LD) across the NPY1R locus: Common polymorphisms discovered by re-sequencing in 4 human populations On-line Figure 1
2
On-line Figure 2 On-line Figure 2: NPY1R 3’-UTR polymorphism A+1050G influences gene expression in cella in 3 different cell lines: PC12 chromaffin cells, human embryonic kidney (HEK) cells, and HeLa fibroblasts. Results are shown at 24 h post-transfection.
3
Human variant TCACTTTACCTAGCAGGGAAAAG-TACACAAAAACTGCAGATACT Human wild-type TCACTTTACCTAGCAGGGAAAAA-TACACAAAAACTGCAGATACT Chimp TCACTTTACCTAGCAGGGAAAAA-TACACAAAAACTGCAAATACT Macaca TCACTTCACCTAGCAGGGAAAAAATACACAAAAACTGAGAATACT Conservation ****** *************** ************* ***** 3’-UTR A+1050G On-line Figure 3A Human NPY1R 3’-UTR Variant Inter-species Sequence Alignment. The alignment shown spans 45 bp flanking the polymorphism. The polymorphic base is shown in uppercase bold type. Asterisks (*) indicate that the position is identical in all sequences shown. Sequence alignment by Clustal-W. On-line Figure 3A
4
Human variant GCTAAGCGCTGGGAACAAATCTGACTTATTGCATTTTCTCAGTGGGCCAAAGAAAGGAGG Human wild-type GCTAAGCGCTGGGAACAAATCTGACTTAATGCATTTTCTCAGTGGGCCAAAGAAAGGAGG Chimp GCTAAGCGCTGAGAACAAATCTGACTTAATGCATTTTCTCAGTGGGCCAAAGAAAGGAGG Rhesus ACTTAGCGCTGGGAACAAATCTGACTTAATGCATTTTCTCAGTGGGCCAAAGAAAGGAGG ** ******* **************** ******************************* A-585T On-line Figure 3B: Human NPY1R promoter variant A-585T inter-species sequence alignment. The alignment shown spans 60 bp flanking the polymorphism. The polymorphic base is shown in uppercase bold type. Asterisks (*) indicates that the position is identical in all sequences shown. Sequence alignment by Clustal-W. On-line Figure 3B
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.