1. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 1 Slide 1 Dr C N Maguire Copyright FSS 2005 11 DNA Profiling

2. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 2 Slide 2 Dr C N Maguire Copyright FSS 2005 There are millions of cells in a adult human Nerves Cardiac CellsSmooth Muscle

3. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 3 Slide 3 Dr C N Maguire Copyright FSS 2005 All cells, except red blood cells, contain genetic information (DNA) in the nucleus.

4. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 4 Slide 4 Dr C N Maguire Copyright FSS 2005 Each nucleus contains genetic information (DNA) that determines physical characteristics

5. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 5 Slide 5 Dr C N Maguire Copyright FSS 2005 Genetic information in DNA is organised and packaged into 46 chromosomes

6. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 6 Slide 6 Dr C N Maguire Copyright FSS 2005 23 pairs of chromosomes, half derived from each parent

7. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 7 Slide 7 Dr C N Maguire Copyright FSS 2005 DNA consists of two long chains of the code running in opposite directions Coiled to form a double helix

8. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 8 Slide 8 Dr C N Maguire Copyright FSS 2005 A T G C T A C G Phosphate/ Sugar Backbone

9. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 9 Slide 9 Dr C N Maguire Copyright FSS 2005 DNA Profiling Process – RFLP technique (to 1994) Extraction – DNA recovered from material under test Purification – chemical processes to clean up recovered DNA Digestion – use Restriction endonuclease to cut up DNA into fragments Electrophoresis – sort DNA fragments by size Labelling – using radioactive or chemiluminescent probes Visualisation & Comparison

10. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 10 Slide 10 Dr C N Maguire Copyright FSS 2005 Extraction Digestion Purification

11. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 11 Slide 11 Dr C N Maguire Copyright FSS 2005 DNA Profiling Process (from 1994 – PCR) Extraction – DNA recovered from material under test Purification – chemical processes to clean up recovered DNA Amplification – copy areas of interest millions of times Electrophoresis – sort DNA fragments by size Analysis – determine characteristics present Comparison

12. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 12 Slide 12 Dr C N Maguire Copyright FSS 2005 Ambient Temperature Denaturation Annealing Extension Cycle 1Cycle 2 Temperature 95 o C 72 o C 40-60 o C PCR Cycle

13. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 13 Slide 13 Dr C N Maguire Copyright FSS 2005 CTAGCTAGCTAGGTCTTTTGAG GATCGATCGATCCAGAAAACTC GATCGATCGATCCAGAAAACTC CTAGCTAGCTAGGTCTTTTGAG Polymerase Chain Reaction - denaturation

14. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 14 Slide 14 Dr C N Maguire Copyright FSS 2005 CTAGCTAGCTAGGTCTTTTGAG GATCGATCGATCCAGAAAACTC TTGAG Polymerase Chain Reaction – Primer Annealing CAGAA

15. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 15 Slide 15 Dr C N Maguire Copyright FSS 2005 CAGAA CTAGCTAGCTAGGTCTTTTGAG CTAGCTAGCTAGTCAAC Polymerase Chain Reaction – Primer Extension CAGAA

16. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 16 Slide 16 Dr C N Maguire Copyright FSS 2005 - ve + ve Polyacrylamide Gel Electrophoresis 0.2mm Gel Matrix

17. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 17 Slide 17 Dr C N Maguire Copyright FSS 2005 Time = rf value Laser detection of fluorescent band in DNA sequencer

18. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 18 Slide 18 Dr C N Maguire Copyright FSS 2005 Sample Blank Ladder

19. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 19 Slide 19 Dr C N Maguire Copyright FSS 2005 Electropherogram

20. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 20 Slide 20 Dr C N Maguire Copyright FSS 2005 Allows the scientist to look at lots of different areas in the DNA to discriminate between people - a bit like blood grouping but much more discriminating

21. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 21 Slide 21 Dr C N Maguire Copyright FSS 2005 The discriminating power of STR DNA profiling is dependent on the number of loci analysed STR SystemDiscriminating Power QUAD (4 loci)1 in 40,000 SGM (6 loci)1 in 50 million SGMplus (10 loci)1 in 1000 million

22. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 22 Slide 22 Dr C N Maguire Copyright FSS 2005 National DNA Database – sampling process  The police take the samples from suspects in police stations  Each sample consists of 2 buccal scrapes or 10 pulled hairs  Police National Computer (PNC) record created, and a unique transaction number (ASN) obtained  This creates the skeleton record on the Database

23. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 23 Slide 23 Dr C N Maguire Copyright FSS 2005 NDNADB – match reporting  All new CJ/SoC profiles added to the NDNAD are checked against all SoC profiles held on the NDNAD  Match reports are issued to the police  scene to suspect  scene to scene  A match report that links a suspect with a scene is a potential detection  New secure web-based system of delivering match reports electronically is being introduced

24. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 24 Slide 24 Dr C N Maguire Copyright FSS 2005 National DNA Database - Current Data April 1995 – 5 November 2006 Suspects profiles held 4,056,644 Crime scene sample profiles held 291,602 Intelligence reports in week ending 05/11/06 Suspect to Scene of crime 875 Suspect to vol. crime (Burglary, car crime) 847 Suspect to serious sexual offence 14 Suspect to suspicious death 14

25. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 25 Slide 25 Dr C N Maguire Copyright FSS 2005

26. Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 26 Slide 26 Dr C N Maguire Copyright FSS 2005