1. Do Now 1. Turn in TNTP permission slips!!!! Also, turn in homework (DNA drawing) and signed progress reports. 2. What are 3 things that we do in class (or you do in another class) that help you learn? Explain. I am creating my lesson plans for next week’s sub and need this info to help you succeed while I am out.

2. Pop quiz 1. List the nitrogenous bases of DNA. 2. What are the components of DNA? 3-7. What are the 5 facts you wrote for The Amoeba Sisters video? 8. What is the purpose of the nitrogen base? 9. What is the purpose of hydrogen? 10. What is the difference between the DNA in a tree versus the DNA in a human? 11. Should I continue teaching at Vance next year? Explain. (There is no right or wrong answer)

3. Module 6 DNA and Protein Synthesis Day 2 of 7 DNA Fantastic! Song

4. SWBAT explain that DNA is a code for making proteins and that the code is found in the sequence of nitrogen bases. determine the complementary nitrogen base sequence when given the sequence of one strand explain the stages of DNA replication

5. 1. What is DNA? 2. Rosalind Franklin was the first to take a clear “picture” of DNA using a technique called X-ray crystallography. The “picture” offered a clue of the shape of DNA. Rosalind Franklin: Great Minds - YouTube Rosalind Franklin: Great Minds - YouTube (4 mins) 2. Watson and Crick received credit for finalizing the model of DNA by using the picture taken by Franklin and by synthesizing work completed by other scientists. Slide 1 of 7

6. What are the 3 parts of a nucleotide? Nucleotide is the monomer for nucleic acids (a major organic molecule) 1) Sugar (DNA’s sugar is Deoxyribose) 2) Phosphate group (together the sugar and phosphate make up the backbone of DNA’s structure) 1) Nitrogen base (this is where the code for heredity is stored) Slide 2 of 7

7. Determining the Complementary Base Pair Sequence: When given one side of the DNA template, you can determine the other side using the rules of complementary base pairing: Ex: T A G G C T G A A C A T C C G A C T T G Note: The sequence above has 10 base pairs. A human has ~ 3 BILLION base pairs in their DNA! Slide 3 of 7

8. DNA Replication WITH ENZYMES ! Process is “semi-conservative” DNA replication explained DNA Replication: The Cell's Extreme Team Sport - YouTube

9. II. Do all my cells have the same DNA ? DNA Replication copies DNA for new cells 1. Because DNA is so important, when a cell divides, it must pass on an exact copy of the DNA to function correctly. 2. DNA gives instructions to each cell to make necessary proteins. 3. Therefore, DNA is replicated during the S phase of the cell cycle (part of interphase) Slide 4 of 7

10. II. Do all my cells have the same DNA ? Process of DNA replication DNA replication explained (1 min)DNA replication explained 1. An enzyme breaks the weak hydrogen bonds between the paired nitrogen bases. This allows DNA to “unzip” as the two strands move apart. 2. The newly unpaired nucleotides are paired (A-T and G-C) with extra nucleotides present in the nucleus. This process is catalyzed by another enzyme. Slide 5 of 7

11. II. Do all my cells have the same DNA ? 3. Enzymes then link the nucleotides along the newly constructed side of the DNA ladder by bonding sugar to phosphate. 4. The DNA is proofread by enzymes for any errors. 5. Each new DNA strand is now half original DNA and half new DNA! (Semi-Conservative) YouTube - DNA ReplicationYouTube - DNA Replication (1 min) Slide 6 of 7

12. Replication in Action! What are the complementary bases to this DNA sequence? (Write both in your travel journal) DNA: TACATTTAACATCGGCGTATACA Complementary Strand???? _ _ _ _ _ _ _ _ _ Slide 7 of 7

13. SWBAT explain that DNA is a code for making proteins and that the code is found in the sequence of nitrogen bases. determine the complementary nitrogen base sequence when given the sequence of one strand explain the stages of DNA replication

14. Group Activity KAHOOT!!!!!! https://play.kahoot.it/#/k/819ee076-0880-4d9c-912e- b7fb54906999

15. Independent Activity Show me you know DNA replication! On your worksheet, A. Fill in the complementary strand. Original DNA: TCCTGACCCCGCCGGGATAT Complementary: AGGACTGGGGCGGCCCTATA B. Split the DNA and fill in the complementary strands to create two complete double helix strands. Strand 1: TCCTGACCCC (original) AGGAC TGGGG (new) TCCTGACCCC (new) AGGACTGGGG (original) complementary strand from example A

16. Homework- Due Friday, March 4 1) Find an article about Rosalind Franklin. Write at least 8 sentences on: a) how her research shaped the discovery of DNA’s structure and b) whether or not you agree with Watson and Crick’s use of her information.

17. Exit Ticket On a separate sheet of paper, you will write/draw/diagram everything you know about DNA for 2 minutes. You will keep your writing utensil moving until I say stop. Then, copy and answer this statement: “From everything we learned today, I can conclude that this is important because ______”