1. Genetic Engineering and Biotechnology

2. Genetic Engineering Genetic Engineering: a sequence of DNA (gene) from one organism is: identified, cut and removed using an ENZYME then inserted into the DNA of another organism.

3. Genetically Engineered Crops The first genetically engineered whole food sold to U.S. consumers was a TOMATO. PRODUCT: A tomato called the FLAVR SAVR by Calgene Has a gene to delay the enzyme that causes the fruit to rot. PBS website on different GMOs PBS website on different GMOs

4. 1. Identifying the GENE Prokaryotes (Bacteria) – DNA is circular and called a PLASMID Easy Eukaryotes – DNA is in the form of chromosomes in the nucleus Challenging

5. 2. Cutting and REMOVING the DNA Restriction ENZYMES: Cuts DNA at specific places in sequence Recognition sequences DNA sequence Restriction enzyme EcoR I cuts the DNA into fragments. Sticky end

6. REGENTS QUESTION GGGATT Base your answer on the information below and on your knowledge of biology. The segments of DNA below were extracted from two different species of plants. The segments represent the same region of DNA that codes for a particular pigment (color) in these species. A restriction enzyme is used to cut the DNA from species A and B The enzyme binds to the sequence G G G A T T and cuts between G and A State how many cuts will be made in the DNA sequences of each species when this enzyme is used.

7. CCGG Regents Q To demonstrate techniques used in DNA analysis, a student was given two paper strip samples of DNA. The two DNA samples are shown below. Sample 1: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC Sample 2: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC The student cut between the C and G in each of the bolded CCGG sequences in sample 1 and between the As in each of the bolded TAAT sequences in sample 2. Both sets of fragments were then arranged on a paper model of a gel. 1. The action of what kind of molecules was being demonstrated when the DNA samples were cut?

8. 3. Separating the DNA Fragments by size Gel Electrophoresis : uses charges to separate the fragments by size. Enzymes cut into fragments **Smaller pieces of DNA move faster and further Negative Charged DNA moves towards positive pole (+ and – attract) by electricity

9. Steps of Gel Electrophoresis http://www.stanford.edu/group/hopes/diagnsis/gentest/f_s02gelelect.gif

10. Which species are more closely related to unknown?

11. Which species are more closely related?

12. 4. Insert Gene into new DNA Recombinant DNA: DNA from 1 organism combined with another to make new DNA Ex: Bacteria made to produce insulin Identify gene for making insulin in humans Cut out gene Insert gene for insulin into plasmid Bacteria goes through cell division, New Bacteria now produces the new protein (Insulin) from inserted gene

15. Human Cell Gene for human growth hormone Recombinant DNA Sticky ends DNA recombination DNA insertion Bacterial Cell Plasmid Bacterial chromosome Bacterial cell for containing gene for human growth hormone Bacteria can be transformed using recombinant DNA; thus the bacteria can now produce the human growth hormone

16. Transgenic Organisms Transgenic organisms-: Contain genes from other organisms Examples of Benefits… Transgenic Bacteria--can produce MASS AMOUNTS of insulin, human growth factor, and clotting factors. This can then be used to treat humans. Transgenic Animals--cattle with extra growth hormone to grow faster and less fatty Chickens resistant to bacterial infections that cause food poisoning Transgenic Plants--with insecticides; resist weed killing chemicals; produce human antibodies; food resistant to rot; rice that adds vitamin A Increases food supply

17. Genetically modified organisms are called transgenic organisms. TRANSGENIC ANIMALS 1. Mice – used to study human immune system 2. Chickens – more resistant to infections 3. Cows – increase milk supply and leaner meat 4. Goats, sheep and pigs – produce human proteins in their milk

18. Transgenic Examples Gene for luciferase, an enzyme that makes lightning bugs glow was isolated. Steven Howell, UC San Diego, inserted it in tobacco chromosomes & it worked!

19. Transgenic Examples Strains of mice have been produced with human genes to make their immune systems act in a similar way to us. Mice used for diabetes research and other disease research

20. Transgenic Plants PLANTS 1. disease-resistant and insect-resistant crops 2. Hardier fruit 3. 70-75% of food in supermarket is genetically modified.

22. What do you think about eating genetically modified foods?

23. Cloning – creating genetically identical organisms from a single cell Dolly, the first mammal was cloned in 1997 they used a **body cell and an empty egg cell Cloning may help be helpful in medical and scientific research. Could possibly help save endangered species Reproduce transgenic organism quickly However there are many ethical issues!!!!!

24. How to Clone “DOLLY” 1. Who is Dolly most closely related to?

25. A donor cell is taken from a sheep’s udder. Donor Nucleus These two cells are fused using an electric shock. Fused Cell The fused cell begins dividing normally. Embryo The embryo is placed in the uterus of a foster mother. Foster Mother The embryo develops normally into a lamb—Dolly Cloned Lamb Egg Cell An egg cell is taken from an adult female sheep. The nucleus of the egg cell is removed. Cloning Dolly version 2

26. Another example

27. answer

28. What is this??

29. Cloning articles