Download presentation
Presentation is loading. Please wait.
Published byBertha Dennis Modified over 8 years ago
1
PCR mediated mutagenesis 2013 년도 2 학기 생화학 실험 (2) 5 주차 조교 : 안성원
2
Procedure : Primary PCR Ingredient for PCR reaction (Primary PCR) Component Quantity per reaction Targets 1-10kb Distilled water35ul 5x Herculase II reaction buffer 10ul dNTP mix0.5ul DNA template1ul Primer 1+3 or 2+42.5ul Herculase II fusion DNA polymerase 1ul Total reaction volume50ul Primary PCR condition Temp.( ℃ ) Time 952min 9530sec 5530sec 7245sec 725min 30 cycles
3
Polymerase Chain Reaction 특정 DNA 부위를 특이적으로 반복 합성하여 시험관내에서 원하는 DNA 분자 를 증폭시키는 방법으로서, 아주 적은 양의 DNA 를 이용하여 많은 양의 DNA 합성이 가능
4
Polymerase Chain Reaction The three steps of PCR Step 1. Denaturation : double strand DNA 를 열에 의해 single strand 로 분리. Step 2. Annealing : DNA primer 가 DNA 에 결합하는 단계. Step 3. Extension : DNA polymerase 에 의해 DNA 합성이 일어나는 단계.
5
Polymerase Chain Reaction
8
Applications of PCR Sub-cloning DNA targets using PCR PCR-meditated in vitro mutagenesis –Site-directed mutagenesis ( 위치 선택적 돌연변이 ) –Overlap Extension PCR Amplification of differentially expressed gene sequences –RT-PCR Identifying genetic mutation –Reverse Genetics Approach etc……
9
Overlap-extension PCR Lee, J et al. BioTechniques 36, 398-400 (2004) PCR-mediated INSERTION mutagenesisPCR-mediated DELETION mutagenesis OE-PCR 은 PCR 방법을 이용하여 단백질 분자 내의 특정 아미노산을 다른 아미노산으로 치환하 는 여러 방법 중 하나이다. 단백질 내의 특정 아미노산만을 다른 아미노산으로 변경하기 위해서 는 치환 아미노산에 해당되는 DNA 염기서열을 유전자상에서 쉽게 치환할 수 있도록 해야 한다. 치환하고자 하는 DNA 염기서열을 변형시키기 위해서 OE-PCR 에서는 4 개의 서로 다른 primer 들 을 사용하여 두 번의 연속적인 PCR 을 수행해야 한다.
10
Primer Primary PCR using chimeric primers –Primer A + Primer B (chimeric primer with primer C sequence) –Primer D + Primer C (chimeric primer with primer B sequence) –Primer B COMPLEMENTARY SEQUENCE Primer C PCR construct purification through gel elution –Intermediate PCR construct (A-B & C-D) Ligation PCR using outer primers (A and D) –Using Intermediate PCR construct (A-B + C-D) as a DNA template –Final product is mutagenized PCR construct which has deleted region
11
Primer design 시 주의사항 1) 길이는 20~30bp 로 제한한다. → 너무 짧으면 결합력이 약하고 너무 길면 시간과 효율면에서 좋지 않음 2) G+C% 가 50~60% 로 구성되어야 하며 purine 과 pyrimidine 염기의 연속적인 배열은 피해야 한다. 3) 한 쌍의 primer 가 부분적으로 서로 상보적이지 말아야 한다. → primer-primer dimer 의 형성 가능성을 배제하기 위함 Primer
12
Primer design 시 주의사항 4) Primer 의 3’ 말단에 G or C 가 3 개 이상 연속적으로 오지 않도록 한다. → 5’ 말단 sequence 는 annealing 에 크게 중요한 역할을 하지 않지만 3’ 말단 sequence 는 PCR product 가 extension 하는 부위이기 때문에 PCR 의 sensitivity 와 specificity 에 중요한 역할을 함. 3 개 이상의 G or C 는 비특이적인 증폭을 야기하므로 피하는 것이 좋음 5) Primer 의 3’ 말단에 T 가 오지 않도록 한다. → Thymine 은 올바르지 못한 다른 염기와 misparing 할 가능성이 높음 6) Tm 값이 동일한 두 primer 설계 ( 또는 차이가 5 ℃이하 까지 설계 ) - Tm value = [4*(G+C) + 2*(A+T)] * annealing temp. = Tm – 3 ℃ (or 5 ℃ ) Primer
13
Homo sapiens tripartite motif containing 41 (TRIM41), transcript variant 2, mRNA 586 cgccccaacctgcagctggccaatatggtccaggtgattcggcag 631 atgcacccaacccctggtcgagggagccgcgtgaccgatcagggc 676 atctgtcccaaacaccaagaagccctgaagctcttctgcgaggta 721 gacgaagaggccatctgtgtggtgtgccgagaatccaggagccac 766 aaacagcacagcgtggtgccattggaggaggtggtgcaggagtac 811 aaggccaaactgcaggggcacgtggaaccactgaggaagcacctg RINCK1-F : 5’ atggctgccgttgccatgac3’ RINCK1-BB-F : 5’ GGTCGAGGGAGCCGCGTG-GAGGAGGTGGTGCAGGAG 3’ RINCK1-BB-R : 5’ CTCCTGCACCACCTCCTC CACGCGGCTCCCTCGACC 3’ RINCK1-R : 5’tcaagtgaagctaaattctg3’ Primer
15
Procedure : Primary PCR Ingredient for PCR reaction (Primary PCR) Component Quantity per reaction Targets 1-10kb Distilled water35ul 5x Herculase II reaction buffer 10ul dNTP mix0.5ul DNA template1ul Primer 1+3 or 2+42.5ul Herculase II fusion DNA polymerase 1ul Total reaction volume50ul Primary PCR condition Temp.( ℃ ) Time 952min 9530sec 5530sec 7245sec 725min 30 cycles
16
Agarose gel electrophoresis of DNA
17
Gel extraction Gel Slice and PCR Product Preparation Dissolving the Gel Slice 1. Following electrophoresis, excise DNA band from gel and place gel slice in a 1.5ml microcentrifuge tube. 2. Add 10μl Membrane Binding Solution per 10mg of gel slice. Vortex and incubate at 50–65°C until gel slice is completely dissolved(10min). Binding of DNA 1. Attach Vacuum Adapter to manifold port and insert SV Minicolumn into Adapter. 2. Transfer dissolved gel mixture or prepared PCR product to the Minicolumn. Incubate at room temperature for 1 minute. 3. Apply vacuum to pull liquid through Minicolumn. Release vacuum when all liquid has passed through Minicolumn.(12,000rpm, 1min) Washing 4. Add 700μl Membrane Wash Solution (ethanol added). Apply a vacuum to pull solution through Minicolumn..(12,000rpm, 1min → 12,000rpm, 1min 30sec~2min EtOH 날라가도록 ) 5. Transfer Minicolumn to a Collection Tube. Centrifuge at 16,000 × g for 5 minutes. 6. Empty the Collection Tube and recentrifuge the column assembly for 1 minute with the microcentrifuge lid open (or off) to allow evaporation of any residual ethanol. Elution 7. Carefully transfer Minicolumn to a clean 1.5ml microcentrifuge tube. 8. Add 50μl of Nuclease-Free Water to the Minicolumn. Incubate at room temperature for 5 minute. Centrifuge 12,000rpm, 3min 9. Discard Minicolumn and store DNA at 4°C or –20°C.
18
Gel extraction
19
Result Gel electrophoresis result 700bp : primer 2 (2-4) 600bp : primer 1 (1-3)
20
제출기한 : 2013 년 10 월 15 일 오후 2 시까지 > 늦게 제출 시 태도점수 감점 제출장소 : 과학원 S401 호 ( 세포주기 연구실 ) Hand-writing 미 제출 시 0 점 처리 인터넷의 자료를 그대로 이용 시 감점처리 질문이 있다면 과학원 S401 호 or 안성원 : 010-5372-9766 Report
21
1. PCR 의 종류를 조사하고, 각각에 대해 간략히 설명 (ex. RT-PCR, RACE, inverse PCR, Multiplex PCR…etc) 2. Taq vs Pfu vs Pfu-x DNA polymerase 비교 3. 실험에 쓰이는 Material 의 역할 4. Gel Data 붙이고, 그 결과에 대해 분석 5. 보편적인 PCR Primer design ( 다음 페이지에 ) Report – 결과 및 고찰
22
5. 보편적인 PCR Primer design → 아래의 sequence 를 이용해 forward primer 와 reverse primer 를 설계하세요. primer design 할 때 주의사항을 염두하여 20~25bp 사이로 설계한 후 짜여진 두 primer 의 Tm 값도 구하세요. Gene Description Homo sapiens corepressor interacting with RBPJ, 1 (CIR1), mRNA. 299 aaggagccccac gagaaaaata tgccaaagat gacatgaaca tcagagatca gccctttggt 361 attcaggttc gaaatgtgag gtgcattaaa tgtcacaaat ggggtcatgt caacacagat 421 cgagaatgtc ctttgtttgg tctttctgga atcaatgcaa gttcggt Report – 결과 및 고찰
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.