1. From: Scheinfeld A (1965) Your heredity and environment. JB Lippincott Company, Philadelphia Phenotypic variation among humans is enormous

3. Phenotypic variation among genetically identical individuals is minimal From: Scheinfeld A (1965) Your heredity and environment. JB Lippincott Company, Philadelphia

4. Are we mere marionettes of our genetic constitution?

5. 100%genetic contribution 0% 0%environmental contribution 100% “Nature vs. nurture” trait genes environment “mendelian” traits infections, accidental injuries “complex” traits

6. What do we mean when we say that a trait is “genetic”? From: Campbell (1990) Biology. 2 nd ed.

7. The human genome From: Weiss KM (1993) Genetic variation and human disease: principles and evolutionary approaches. Cambridge University Press, Cambridge 23 (x 2) chromosomes ~3,000,000,000 (x 2) bp of DNA ~30,000 (?) genes geneticist’s haystack: Where/what are the genes influencing the trait of interest?

8. From: Weiss KM (1993) Genetic variation and human disease: principles and evolutionary approaches. Cambridge University Press, Cambridge What is a gene?

9. Genetic variation in numbers There are ~6 x 10 9 humans on earth, and thus ~12 x 10 9 copies of each autosomal chromosome. Assuming a mutation rate of ~1 x 10 - 8, every single nucleotide will be mutated (~12 x 10 9 ) / (~1 x 10 -8 ) = ~120 in each new generation of earthlings. Thus, every nucleotide will be polymorphic in Homo sapiens, except for those where variation is incompatible with life. Any 2 chromosomes differ from each other every ~1,000 bp. The 2 chromosomal sets inherited from the mother and the father (each with a length of 3 x 10 9 bp) therefore differ from each other at ~3 x 10 9 / ~1,000 = ~ 3 x 10 6, or ~3 million, locations.

10. “Marker” loci There are many different types of polymorphisms, e.g.: single nucleotide polymorphism (SNP): AAACATAGACCGGTT AAACATAGCCCGGTT microsatellite/variable number of tandem repeat (VNTR): AAACATAGCACACA----CCGGTT AAACATAGCACACACACCGGTT insertion/deletion (indel): AAACATAGACCACCGGTT AAACATAG--------CCGGTT restriction fragment length polymorphism (RFLP) …

11. Genotype determines phenotype genotypephenotype penetrance = P(phenotype | genotype) detectance = P(genotype | phenotype) but evolution acts on phenotypes…

12. Relationship between genotypes and phenotypes (penetrances) at the ABO blood group locus Phenotype (blood group) GenotypeABABO A/A1000 A/B0010 A/O1000 B/B0100 B/O0100 O/O0001 penetrance: P(phenotype given genotype)

13. Probability model correlating trait phenotypes and trait locus genotypes: penetrances penetrance: P(phenotype given genotype) Genotypeunaffectedaffected +/+10 D/+ or +/D01 D/D01 Ex.: fully-penetrant dominant disease without “phenocopies” Phenotype

14. Qualitative and quantitative traits qualitative or discrete traits: –disease (often dichotomous; assessed by diagnosis): Huntington’s disease, obesity, hypertension, … –serological status (seropositive or seronegative) –Drosophila melanogaster bristle number quantitative or continuous traits: –height, weight, body mass index, blood pressure, … –assessed by measurement

15. discrete trait (e.g. hypertension) continuous trait (e.g. blood pressure) 01

16. Pros and cons of disease vs. quantitative trait disease for rare disease, limited variation in random sample; need for non- random ascertainment sometimes difficult/impossible to find large pedigrees (e.g. for late- onset diseases) diagnosis (sometimes difficult, subjective, arbitrary) treatment may cure disease or weaken symptoms, but original disease status is generally still known of great clinical interest often more complex etiology often less statistical power quantitative trait sufficient variation in random sample; non-random ascertainment may not be necessary or advisable easy to find large pedigrees measurement (often straight-forward, reliable) medications and other covariates may influence phenotype often only of limited/indirect clinical interest often simpler in etiology often more statistical power + + + + + + +

17. Dichotomizing quantitative phenotypes generally leads to loss of information unaffectedaffected

18. Information loss from dichotomizing a quantitative trait (assuming random ascertainment)