1. The Case of the Crown Jewels: Investigate a Crime Scene Using DNA Restriction Analysis (DNA Fingerprinting) Module developed at Boston University School of Medicine Presented by Dr. Dan Murray

2. Outline DNA Structure Restriction Enzymes DNA Fingerprinting Simple Tandem Repeats (STRs) DNA Synthesis Polymerase Chain Reaction (PCR)

3. DNA Structure

4. What is DNA made of? Nucleotides: Phosphate Sugar Base Carbon atoms of sugar are numbered

5. = one strand of DNA Note polarity Nucleotide 1 Nucleotide 2 Nucleotide 3 Nucleotide 4

6. Nucleotide 1 Nucleotide 2 Nucleotide 3 Nucleotide 4 one strand of DNA PSPSPSPSPSPSPSPS A G T C

7. PSPSPSPSPSPSPSPS A G T C PSPSPSPSPSPSPSPS G A C T 5’ 3’ Two strands of DNA Double-stranded DNA Anti-parallel Hydrogen bonds AT or GC pairs

8. PSPSPSPSPSPSPSPS A G T C PSPSPSPSPSPSPSPS G A C T 5’ 3’

9. Restriction Enzymes

10. Also called restriction enzymes Occur naturally in bacteria Hundreds are purified and available commercially Named for bacterial genus, species, strain, and type Example:EcoRI Genus: Escherichia Species: coli Strain: R Restriction endonucleases

11. Recognize specific base sequences in DNA Cut DNA at those recognition sites Restriction endonucleases

12. Enzymes recognize specific 4-8 bp sequences EcoRI5’…GAATTC…3’ 3’…CTTAAG…5’ Recognition sites have symmetry Some enzymes cut in a staggered fashion Some enzymes cut in a direct fashion PvuII5’…CAGCTG…3’ 3’…GTCGAC…5’ Restriction Enzyme Recognition Site

13. Products generated by restriction enzymes COHESIVE END CUTTERS (staggered cuts): Enzyme Recognition Site Ends of DNA After Cut EcoRI5’…GAATTC…3’5’…GAATTC…3’ 3’…CTTAAG…5’3’…CTTAA G…5’ PstI5’…CTGCAG…3’5’…CTGCA G…3’ 3’…GACGTC…5’3’…GACGTC…5’ BLUNT END CUTTERS (direct cuts): Enzyme Recognition Site Ends of DNA After Cut HaeIII5’…GGCC…3’ 5’…GG CC…3’ 3’…CCGG…5’ 3’…CC GG…5’

14. Average distance between cuts is: 4n4n where “n” is number of bp’s in recognition site. 4-base cutter:4 4 = 256 bp 5-base cutter:4 5 = 1,024 bp 6-base cutter:4 6 = 4,096 bp 8-base cutter:4 8 = 65,536 bp Frequency of cutting

15. DNA Fingerprinting

16. Determination of an individual’s unique collection of DNA restriction fragments

17. Collect Tissue Sample How to do DNA Fingerprinting The Big Picture >1000 cells RFLP / Southern blotPCR Analysis RFLP / Southern blot >20 cells

18. RFLP Analysis RFLP – Restriction Fragment Length Polymorphism; for related DNA molecules, a difference in DNA fragment sizes after restriction enzyme digestion –Difference results from presence of different DNA sequences –Certain regions of genome are highly variable

19. AGATCT Wild-type allele Mutant allele TCTAGA A single nucleotide change can make a difference AGAGCT TCTCGA Restriction site Not a restriction site

20. Example: Sickle-cell allele destroys an MstII site

21. Need to Analyze only a Small Fraction of Genome Human genome is too big to analyze: 3 x 10 9 base pairs  65,536 bp between cuts = ~46,000 bands Most regions of genome are not suitable: 99.9% of DNA sequence is same from one person to the next Solutions: Limit analysis to a few genomic regions Focus on regions which are highly variable

22. How to Focus on Specific Regions of Genome Need a probe: A short single stranded DNA which is complementary to the region of interest CAGTATACACAAGTACCGTACCTGGCTCAGTTATACGCCGA A probe will base pair to the region of interest GTCATATGTGTTCATGGCATGGACCGAGTCAATATGCGGCT ::::::::::::::::::::::::::::::::::::::::: ATGGCATGGACC :::::::::::: probe

23. Southern Blotting

24. Simple Tandem Repeats (STRs)

25. Simple Tandem Repeats (STR’s) STR – region of DNA containing tandem copies of di-, tri- or tetranucleotide repeat units. Examples: Dinucleotide repeats: GTGTGTGTGTGT…… Trinucleotide repeats:ACGACGACGACG…… Tetranucleotide repeats:TATCTATCTATC……

26. More on STRs Number of repeats varies greatly between individuals STRs make up 10-15% of the mammalian genome STRs are also called “microsatellites” STRs are “junk DNA”

27. Regions of Chromosome Analyzed for DNA Fingerprinting Often Contain STRs ACTACT Person 1 ACTACT 100 ACT repeats EcoRI Person 2 ACTACT 400 ACT repeats EcoRI EcoRI fragment from Person 2 is 900bp longer than in Person 1

28. DNA Synthesis

29. Separate strands DNA Replication is Semi-Conservative AGTCAGAGTCAG TCAGTCTCAGTC ------------ 5 5 3 3 TCAGTCTCAGTC AGTCAGAGTCAG 5 5 3 3 AGTCAGAGTCAG AGTCAGTC ------------ ------------ AGTCAGTC TCAGTCTCAGTC 5 53 3 5 5 3 3 AGTCAGAGTCAG TCAGTCTCAGTC ------------ ------------ AGTCAGAGTCAG TCAGTCTCAGTC 5 53 3 5 53 3 Add correct bases

30. Building a Strand of DNA DNA polymerase – enzyme that synthesizes DNA DNA polymerase can only add nucleotides to the 3´ end of a strand DNA polymerase cannot build a new strand without a primer

31. DNA Polymerase Needs a Primer 3´5´ ss DNA + Nucleotides (dNTPs) + DNA polymerase = No DNA synthesis

32. DNA Polymerase Needs a Primer 3´5´ ss DNA + Nucleotides (dNTPs) + DNA polymerase = DNA synthesis 5´3´ primer

33. DNA Polymerase Needs a Primer 3´5´ ss DNA + Nucleotides (dNTPs) + DNA polymerase = DNA synthesis 5´ primer

34. Polymerase Chain Reaction (PCR)

35. Collect Tissue Sample How to do DNA Fingerprinting The Big Picture >1000 cells RFLP / Southern blotPCR Analysis >20 cells

36. PCR Purpose – Quickly make many copies of a region of a DNA molecule Method – Multiple rounds of DNA replication Components in PCR reaction – Target DNA, nucleotides, DNA polymerase, and primers Temperature cycling – DNA replication controlled by temperature…

37. Temperature Cycling in PCR Temperature cycling – PCR process uses a machine (thermocycler) in which PCR reaction goes through ~30 cycles of three different temperature changes: ~95ºC – Melting temperature 50-65ºC – Annealing temperature 72ºC – Extension temperature

38. Polymerase chain reaction (PCR) analysis 1). primers are designed to flank the region to be amplified in target DNA 2). primers are annealed to denatured DNA 3). DNA is synthesized using Taq polymerase (from Thermus aquaticus) 4). primers are annealed again and the process is repeated through 20-30 cycles, geometrically amplifying the target sequence 5). DNA is analyzed by gel electrophoresis 1). 2). 3).

39. 4).