2. From Gene to Protein (or what are those sequences of nucleotides trying to say?)

3. What led to this idea that genes code for proteins? Experiments by Beadle and Tatum? What did they do? Bread mold, X-rays, and growth medium…put it all together for me! What was up with the precursors to arginine?

4. What do genes code for? Based on their findings, Beadle and Tatum came up with a hypothesis called… Which hypothesis revised the one gene- one enzyme hypothesis? Why is this name more accurate?

5. A closer look…

6. How do we get from gene to polypeptide? Does the gene actually build the protein? So what gets us to protein synthesis? Write a paragraph using these terms: nucleus, primary transcript, nuclear pore, transcription, RNA processing, mRNA, gene, ribosomes, amino acid, tRNA, peptide bond, nucleotide sequence, and translation…go ahead, I’ll wait.

7. So here’s what we’re looking for…

8. On to the genetic code… If one nucleotide in DNA specified one amino acid, how many amino acids could we code for? If two nucleotides? Three? Which one is it? Why? What do we call this three letter code? What are codons? How many codons does it take to screw in a light bulb? I kid, I kid, if you have a polypeptide that is 200 amino acids long, how many codons are required? How many nucleotides? Is the mRNA transcribed from the template or coding strand? Why?

9. Activity – let’s see how good you are… The genetic code has been changed. Each codon now codes for either a letter from the alphabet or a punctuation mark. You have the following sequence in the template strand of DNA

10. 3’ – TGTAGGGAATAGGTACATAGAATTGT TTCC- 5’ Transcribe the following template strand of DNA. Translate the mRNA using the genetic code table provided. Find the message!

11. Cracking the Code How was it done? Does every one of the ___ codons code for an amino acid? What is up with AUG? Reading frames – symbols in a language must be read in the correct groupings.

12. Bow down to the code…

13. Transcription The first part of the central dogma of molecular biology (and gene expression) What are we making here? What enzyme is involved. How many versions of this enzyme are there in euks? Which one is used for mRNA?

14. Can you write a short paragraph using the following.. Initiation, elongation, termination, RNA polymerase, promoter, terminator, transcription initiation complex, transcription unit, TATA box, start point. Didn’t think so. How about a picture…

15. Transcription up close and personal

16. How it all begins…

17. How does it end? Depends on the organism. When RNA polymerase transcribes a specific sequence of DNA called the polyadenylation signal sequence that codes for…you can guess, other proteins snip the pre-mRNA off while the RNA polymerase continues for a while longer down the template strand.

18. We’re not done with you yet, RNA! I’m gonna pop a 5’ cap in your…a modified guanine cap that is. And a whole mess of adenines (A) on the other end. Ripping out the ______ and ______ the exons together give us the functional mRNA molecule with a continuous coding sequence.

19. Snurps, spliceosomes, and ribozymes

20. How do introns and exons help? It’s what Phoenix said. Alternative RNA splicing. Leaves more room for crossing over. Why is this good?

21. Do it again… Write me a paragraph with the following: tRNA, two dimensional structure, anticodon, amino acids, aminoacyl- tRNA synthetase, mRNA, mRNA binding site, small ribosomal subunit, large ribosomal subunit, A site, P site, E site. Forget it, let’s look at some pictures.

22. Translation…the big picture

23. tRNA

24. The Matchmaker

25. Three stages of translation What are they (think back to transcription)? Intiation – what gets put together here? Elongation – what gets put together here? Termination – what goes bye-bye here? Pictures…more pictures.

26. Initiation GTP  GDP

27. Elongation – 3 steps

28. Termination – look no anticodon.

29. So now what? Folding happens. How? Primary structure, chaperonins, and enzymes play a role. How do the polypeptides know where to go? Helps to think about where polypeptide synthesis begins and where it ends up A picture…of course.

30. Check it out…

31. Mutations What do they do? How does that affect the protein. Are they always bad? Different kinds? Yes, I suggest flash cards.

32. In conclusion