1. 1

2. Transcription and Translation 2copyright cmassengale

3. 3 Pathway to Making a Protein DNAmRNA tRNA (ribosomes) Protein copyright cmassengale

4. 4 DNA  RNA  Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell copyright cmassengale

5. 5 Transcription Requires the enzyme RNA Polymerase copyright cmassengale

6. 6 Template Strand copyright cmassengale

7. 7 Transcription During transcription, RNA polymerase binds to DNA and separates the DNA strands RNA Polymerase then uses one strand of DNA as a template to assemble nucleotides into RNA copyright cmassengale

8. 8 Transcription Promoters are regions on DNA that show where RNA Polymerase must bind to begin the Transcription of RNA Called the TATA box Specific base sequences act as signals to stop Called the termination signal

9. 9 RNA Polymerase copyright cmassengale

10. 10 mRNA Processing After the DNA is transcribed into RNA, editing must be done to the nucleotide chain to make the RNA functional Introns, non-functional segments of DNA are snipped out of the chain copyright cmassengale

11. 11 mRNA Editing Exons, segments of DNA that code for proteins, are then rejoined by the enzyme ligase A guanine triphosphate cap is added to the 5” end of the newly copied mRNA A poly A tail is added to the 3’ end of the RNA The newly processed mRNA can then leave the nucleus copyright cmassengale

12. 12 CAP Tail New Transcript Result of Transcription copyright cmassengale

13. 13 Ribosomes Made of a large and small subunit Composed of rRNA (40%) and proteins (60%) Have two sites for tRNA attachment --- P and A copyright cmassengale

14. 14 Step 1- Initiation mRNA transcript start codon AUG attaches to the small ribosomal subunit Small subunit attaches to large ribosomal subunit mRNA transcript

15. 15 Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

16. Step 2 - Elongation As ribosome moves, two tRNA with their amino acids move into site A and P of the ribosome Peptide bonds join the amino acids 16copyright cmassengale

17. 17 Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

18. 18 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation copyright cmassengale

19. 19 mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

20. 20 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

21. 21 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

22. 22 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

23. 23 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

24. 24 mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

25. 25 End Product –The Protein! The end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199

26. 26 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

27. 27copyright cmassengale

28. https://www.youtube.com/watch?v=41_ Ne5mS2ls 28