Presentation is loading. Please wait.

Presentation is loading. Please wait.

RNA AND PROTEIN SYNTHESIS. Central Dogma of Biology! Genes are codes for making polypeptides (proteins) The nitrogenous bases (ATCG’s) contain the code!

Published byZoe Evans Modified over 8 years ago

Similar presentations

Presentation on theme: "RNA AND PROTEIN SYNTHESIS. Central Dogma of Biology! Genes are codes for making polypeptides (proteins) The nitrogenous bases (ATCG’s) contain the code!"— Presentation transcript:

1 RNA AND PROTEIN SYNTHESIS

2 Central Dogma of Biology! Genes are codes for making polypeptides (proteins) The nitrogenous bases (ATCG’s) contain the code! DNA is stored in the nucleus and proteins are made in the cytoplasm

3 How your cell makes very important proteins 1.Transcription – copy of the code 2. Translation – translation into proteins DNA  RNA  ProteinDNA  RNA  Protein Such as…. Insulin, testosterone, human growth hormone, amylase, serotonin, melatonin, melanin, dystrophin, platlets etc.…...

4 Before making proteins, Your cell must first make RNA Question:Question: RNA(ribonucleic acid) DNA (deoxyribonucleic acid)How does RNA (ribonucleic acid) differ from DNA (deoxyribonucleic acid)?

5 RNADNA RNA differs from DNA RNAsugar ribose 1.RNA has a sugar ribose DNAsugar deoxyribose DNA has a sugar deoxyribose RNAuracil (U) 2.RNA contains uracil (U) DNAthymine (T) DNA has thymine (T) RNAsingle-stranded 3.RNA molecule is single-stranded DNAdouble-stranded DNA is double-stranded

6

7 1. Transcription OR RNA production RNA molecules are produced by copying part of DNA into a complementary sequence of mRNA This process is started and controlled by an enzyme called Helicase – “unzips” the double stranded DNA.

8 1. Transcription DNA mRNA (messenger RNA) Helicase Helicase opens the DNA and DNA polymerase Adds base pairs to the mRNA strand. (copy of the DNA)

9 Question: RNADNAWhat would be the complementary RNA strand for the following DNA sequence? Remember U replaces T DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’

10 Types of RNA Three types ofRNAThree types of RNA: A.messenger RNA (mRNA) B.transfer RNA (tRNA) C.ribosome RNA (rRNA)

11 mRNA Carries instructions from DNA to the rest of the ribosome. Tells the ribosome what kind of protein to make Acts like an email from the principal to the cafeteria lady.

12 A. Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1 Bases are read as three letter codons

13 rRNA Part of the structure of a ribosome Location in the cytoplasm where translation occurs Helps in protein production tRNA Gets the right amino acids to make the right Protein according to mRNA copy of instructions

14 B. Transfer RNA (tRNA) methionine

15 Ribosomes P Site A Site Large subunit Small subunit mRNA

16 2. RNA Processing pre-RNA molecule intron exon Mature RNA molecule exon intron splicesome

17 3. Translation Three parts: initiation 1.initiation: start codon (AUG) - Primer elongation 2.elongation: codon is read and amino acid attached. termination 3.termination: stop codon (UAG) Watch a PROTEIN being made!!!!!Watch a PROTEIN being made!!!!!

18 3. Translation P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

19 Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC HIS HIS Tyr anticodon hydrogen bonds codon

20 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG HIS Asp AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

21 mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G Tyr Asp AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

22 mRNA AUGCUACUUCG 2-tRNA G Tyr Asp AU A peptide bonds 3-tRNA GAA Glu 4-tRNA GCU Ala ACU

23 mRNA AUGCUACUUCG 2-tRNA G Tyr Asp AU A peptide bonds 3-tRNA GAA Glu 4-tRNA GCU Ala ACU (leaves) Ribosomes move over one codon

24 mRNA GCUACUUCG Tyr Asp A peptide bonds 3-tRNA GAA Glu 4-tRNA GCU Ala ACU UGA 5-tRNA Stop

25 mRNA GCUACUUCG Tyr Asp A peptide bonds 3-tRNA GAA Glu 4-tRNA GCU Ala ACU UGA 5-tRNA Stop Ribosomes move over one codon

26 mRNA ACAUGU His Asp U primarystructure of a protein Glu 200-tRNA Ala UAG Stop CU terminator or stop or stop codon codon Termination

27 End Product primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein. amino acid peptide bondsA sequence of amino acid bonded together by peptide bonds. Tyr Asp Glu Ala Stop

28 Question: The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid.The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid. What would be the DNA base code for this amino acid?What would be the DNA base code for this amino acid?

29 Answer: tRNA - UAC (anticodon)tRNA - UAC (anticodon) mRNA- AUG (codon)mRNA- AUG (codon) DNA - TACDNA - TAC

30 Mutations changing of the structure of a gene, resulting in a variant form that may be transmitted to subsequent generations, caused by the alteration of single base units in DNA Types: deletion, insertion, substitution, repeats, rearrangement

31

Download ppt "RNA AND PROTEIN SYNTHESIS. Central Dogma of Biology! Genes are codes for making polypeptides (proteins) The nitrogenous bases (ATCG’s) contain the code!"

Similar presentations

RNA AND PROTEIN SYNTHESIS

RNA AND PROTEIN SYNTHESIS
copyright cmassengale

copyright cmassengale
Dr. Maha Daghestani DNA structure and function Dr. Maha Daghestani November 2007.

Dr. Maha Daghestani DNA structure and function Dr. Maha Daghestani November 2007.
PROTEIN SYNTHESIS Higher Level Learning Outcomes At the end of this topic you should be able to 1. Outline the steps in protein synthesis 2.Know that.

PROTEIN SYNTHESIS Higher Level Learning Outcomes At the end of this topic you should be able to 1. Outline the steps in protein synthesis 2.Know that.
PROTEIN SYNTHESIS.

PROTEIN SYNTHESIS.
PROTEIN SYNTHESIS.

PROTEIN SYNTHESIS.
Nucleic Acids.

Nucleic Acids.
RNA.

RNA.
Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.

Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.
 2 phases  2 phases : 1.Transcription 2.Translation  DNA  RNA  Protein.

 2 phases  2 phases : 1.Transcription 2.Translation  DNA  RNA  Protein.
Protein Synthesis Human Biology. DNA Deoxyribonucleic Acid Twisted ladder or double helix Nucleotides Composed of alternating sugar (Deoxyribose) and.

Protein Synthesis Human Biology. DNA Deoxyribonucleic Acid Twisted ladder or double helix Nucleotides Composed of alternating sugar (Deoxyribose) and.
Structure & concept of gene, One gene one enzyme hypothesis, Genetic Code PROTEIN SYNTHESIS, Regulation of gene expression Dr. Madhumita Bhattacharjee.

Structure & concept of gene, One gene one enzyme hypothesis, Genetic Code PROTEIN SYNTHESIS, Regulation of gene expression Dr. Madhumita Bhattacharjee.
copyright cmassengale

copyright cmassengale
PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.

PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.
DNA mRNA Protein.  Every living thing is made up of cells.  There are differences between different types of cells, but they’re made of the same building.

DNA mRNA Protein.  Every living thing is made up of cells.  There are differences between different types of cells, but they’re made of the same building.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation.

1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation.

1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA.

1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA.
Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.
Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message.

Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message.

Similar presentations

Ads by Google