2. Transcription & Translation

3. It’s all about making...

4. Here is an... DNA not only stores information, but accurately passes it on through replication & RNA transcription.

5. DNA unwinds and unzips (Helicase). RNA Polymerase binds to and moves along a DNA strand. RNA nucleotides are joined in order complimentary to the DNA nucleotide sequence. Coding Strand Helicase & RNA polymerase Helicase & RNA polymerase

6. A nice image of the same thing! mRNA Nucleotides Helicase & Helicase &

8. There are three kinds of... 1) mRNA (Messenger) 2) rRNA (Ribosomal) 3) tRNA (Transfer)

9. Messenger RNA (mRNA) carries the DNA message out of the nucleus and into the cytoplasm to ribosomes, the site of protein synthesis. Single strand complementary to the template strand.

10. Transfer RNA (tRNA) leaves the nucleus, binds to the amino acid specified by it’s anticodon and transfers it to the ribisome where it meets up with mRNA to assemble a protein. Single strand complementary to the coding strand. tRNA UACGGCAAUCUGGCAAUCGCCUGGACUG tRNA

11. Processing results in a “T” shape, with an amino acid binding site at one end and an anticodon at the other.

12. Ribosomal RNA (rRNA) is RNA in globular form. It joins with 83 proteins to form a ribosome. The sites labeled “P” and “A” bind tRNA. The “groove” formed between the two subunits is the site of mRNA binding.

13. AKA

14. Here is an... DNA not only stores information, but accurately passes it on through replication & RNA transcription.

15. Here’s where it all comes together!!! Here’s where it all comes together!!! mRNA, carrying the codon and tRNA, carrying the anticodon, meet at the ribosome (rRNA) to piece together amino acids.

16. Ribosome rRNA + Protiens Ribosome rRNA + Protiens Here’s how it works...

23. Here it is all together!

24. A nice image of the same thing! Codon Anticodon

25. The result... This is a representation of one molecule of hemoglobin. It is the result of amino acids strung together into peptides, joined to form polypeptides which combine to make up the final protein.

26. A nice image of a protein being made! Codon Anticodon

27. How about a review?